In and out M 3. What are restriction enzymes used for in nature? are used by backsta ta bock ria to cat yo Restriction enzymes are used the DNA. 4. Look at the Jellyfish Glo gene. The start (TAC) and stop (ACT) DNA sequences of the gene are marked by black boxes. What process are they the start and stop of? 5. Why did we make sure to include these start and stop DNA sequences for the Jellyfish Glo gene in our cut segment? 6. If we want to now produce a lot of this Jellyfish Glo protein, what do we have to do now with the transformed bacteria to get a lot of protein from them? procedure. 7. Identify the structure in each section of the diagram and explain what its role is in this whole

In and out M 3. What are restriction enzymes used for in nature? are used by backsta ta bock ria to cat yo Restriction enzymes are used the DNA. 4. Look at the Jellyfish Glo gene. The start (TAC) and stop (ACT) DNA sequences of the gene are marked by black boxes. What process are they the start and stop of? 5. Why did we make sure to include these start and stop DNA sequences for the Jellyfish Glo gene in our cut segment? 6. If we want to now produce a lot of this Jellyfish Glo protein, what do we have to do now with the transformed bacteria to get a lot of protein from them? procedure. 7. Identify the structure in each section of the diagram and explain what its role is in this whole

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter18: Dna Technologies: Making And Using Genetically Altered Organisms, And Other Applications

Section: Chapter Questions

Problem 9TYK

See similar textbooks

Similar questions

Part 4. Putting It Together 1) Consider the diagram below as well as the given information. This diagram represents a piece of circular DNA which was cut in 4 separate reactions (4 different test tubes, each with some of this DNA in it). One digest was done with AvaI, another with ClaI, a third with EcoRV, and a fourth with ScaI. The locations of the recognition sequences for each restriction enzyme are shown along with the location of that site in bp along the circle (it goes clockwise from position 1). You run an agarose gel with a molecular weight marker in the first lane, the AvaI digest in lane 2, the ClaI digest in lane 3, the EcoRV digest in lane 4, and the ScaI digest in lane 5. a) Use the space below and draw out the agarose gel described above. Use your drawing to answer the next questions. b) How many bands of DNA are there in lane 3? c) How many bands of DNA are there in lane 5? d) There would be 2 bands of DNA in lane 4. How big are they? e) Which lane…
ull rain LTE 11:53 © 1 0 A 10% Done #1 Mol Bio Restriction Analysi... Complete the following problems. Restriction enzymes (REs), which cut D NA at specific sequences, are classic tools in molecular biology. Because of their specificity in cutting DNA, REs can be used to "map" DNA sequences by analyzing the fragments generated upon restriction digest, as in the example shown in Figure 1. Your task is to study the circular plasmid, pMBBS, through restriction digests. You subjected the PMBBS plasmid to complete digestion by different combinations of three REs (EcoRI, BamHI, and Xhol), and analyzed the results on an agarose gel, shown below. Using the data you can glean from this gel, answer the questions that follow. EcoRI BamHI Xhol DNA size ladder 600 bp 500 bp 400 bp 300 bp 200 bp 100 bp VC 100bp Plus DNA ladder from Vivantis Technologies *The same total amount of DNA was loaded in each lane. 1. What is the total size of the PMBBS plasmid in bp? Answer: bp 2. How many cut sites on the…
Part 3. Compare the Specificity of DNA-Cutting Tools The flexibility and specificity of CRISPR-Cas9 technology offer a large step forward for gene editing. The first DNA "scissors" were restriction enzymes, which cut DNA at predefined sequences, typically 4-8 base pairs long. For example, EcoRI, a restriction enzyme found in E. coli, will cut double- stranded DNA at every GAATTC sequence. If EcoRI were added to a sample that contained the entire human genome, it could cut at every GAATTC sequence. We can calculate the probability that a particular nucleotide sequence, such as GAATTC, will occur within a larger sequence. Table 1 below shows the calculated probabilities of finding sequences of particular lengths. These calculations are based on the assumption that DNA sequences are entirely random and that every nucleotide position has an equal probability of being A, T, C, or G. Use the table to answer the following questions. Table 1. Calculated probabilities of finding a specific…
Section A: Linear DNA Common restriction enzymes include: EcoRI, Hindll and BamHl and their sequences are as follows, with the cut site indicated by the arrow (figure 1). Please note that A DNA refers to linear DNA in this tutorial. HindIII 5'..A AGCT.3' 3'....TTCGA A...5' EcoRI 5'..G AATTC...3 BamHI 5'....G GATCC...3' 3' .....CTTAA G..5 3'...CCTAG G...5' Figure 1: Restriction sites of restriction enzymes. When DNA is cut with restriction enzymes, the fragments can be seen on an agarose gel (see figure 2). Base Pairs 21220 25.000 10.000 8,000 6.000 5,000 6557 4361 1641 7233 4,000 3,000 2,500 7421 2.000 5804 E643 1,500 1.000 4878 750 -564 S00 E 3530 125 250 A cut with EcORI A cut with Hindil A cut with BamHI A C D Figure 2: DNA fragments on an agarose gel showing the following: A) a molecular ladder, B) DNA cut with EcoB, C) DNA cut with Hipd, D) DNA cut with Bam The above figure shows the size of each of the fragments/bands produced when A DNA is cut with each of these restriction…
Part A Which of the following statements concerning restriction enzymes is true? Select all that apply. ►View Available Hint(s) ☐ Restriction enzymes specifically target and cut RNA in a sequence-specific manner. Restriction enzymes occur naturally in viruses as a defense mechanism against bacteria. Some restriction enzymes generate overhangs in the target DNA sequence upon incubation. During a cloning experiment, the vector and target DNA should be cut with different restriction enzymes to ensure that sticky ends are generated. Submit
Part 2. PCR 1) In one color, write out the forward primer (5’ GATAC 3’) in the correct position relative to the given template DNA sequence. In a second color, act as the polymerase and fill in the rest of the new strand of DNA Primer/New Strand Template DNA: 3’ TAGCTATGCGGACCTCATGCATTAGAGTAG 5’ Part 3. Restriction Enzymes 1) Consider the sequence of DNA given below and answer the following questions 5’ ATTGAGGATCCGTAATGTGTCCTGATCACGCTCCACG 3’ 3’ TAACTCCTAGGCATTACACAGGACTAGTGCGAGGTGC 5’ a) You cut the sequence of DNA shown above using BamHI (see table 19.1 from the text). How many fragments of DNA would you expect to result from this restriction digest? b) If you cut the sequence of DNA shown above using BclI (recognition sequence = 5’ TGATCA 3’, enzyme cuts after the first T) instead of BamHI how many fragments do you expect? 2) For each given sequence/restriction enzyme pair, determine how many pieces of DNA would result form the digest and…
Part 3. Restriction Enzymes 1) Consider the sequence of DNA given below and answer the following questions 5’ ATTGAGGATCCGTAATGTGTCCTGATCACGCTCCACG 3’ 3’ TAACTCCTAGGCATTACACAGGACTAGTGCGAGGTGC 5’ a) You cut the sequence of DNA shown above using BamHI (see table 19.1 from the text). How many fragments of DNA would you expect to result from this restriction digest? b) If you cut the sequence of DNA shown above using BclI (recognition sequence = 5’ TGATCA 3’, enzyme cuts after the first T) instead of BamHI how many fragments do you expect? 2) For each given sequence/restriction enzyme pair, determine how many pieces of DNA would result form the digest and indicate whether those pieces would have blunt or sticky ends. NOTE: in the given recognition sites, the dash represents where the cut is made. a) HpaI, recognizes 5’ GTT – AAC 3’ 5’ GGATGTTAACAATCTCTACGGGTTAACACCCTTGGGTTAACATCCGCGG 3’ 3’ CCTACAATTGTTAGAGATGCCCAATTGTGGGAACCCAATTGTAGGCGCC 5’ Number of fragments of DNA:…
Formation of a recombinant DNA molecule. 1 GAATTC GAATTO CITAAG CTTAAG double-stranded DNA CAATTO BAATTO CTTAA CITAAT (| AATTC GI AATTC CTTAA IG GHATIC СТТАА G In the above diagram, 1' represents the O sticky ends re striction sites primer O restriction fragments
Restriction digestion and Gel electrophoresis: A single strand of a double-stranded DNA sequence is shown below. Draw a complementary DNA strand and show the restriction digestion pattern of the double-stranded DNA with BamHI and Pst1. Show the separation pattern of the undigested and the digested DNA on your agarose gel. Label the gel appropriately. 5’ – CGAGCATTTGGATCCTGTGCAATCTGCAGTGCGAT – 3’
Some Steps Involved in Creating Recombinant DNA 1. Plasmid DNA is cut at the restriction site.2. Foreign DNA is cut at the restriction site.3. Plasmid DNA is opened and sticky ends are formed.4. Foreign DNA restriction fragments are isolated5. Target sequence in the plasmid is recognized by the restriction endonuclease.6. Target sequences in the foreign DNA are recognized by the restriction endonuclease.7. Foreign DNA restriction fragment is inserted into the plasmid at the restriction site.8. DNA ligase splices the foreign restriction fragment and the plasmid together. Identify the correct sequence of steps involved in cutting and reassembling DNA molecules to make recombinant DNA. Start with preparation of the plasmid DNA. Select one: a. 6, 2, 4, 7, 8, 5, 1, 3 b. 5, 1, 3, 6, 2, 4, 8, 7 c. 5, 1, 3, 6, 2, 4, 7, 8 d. 6, 2, 4, 5, 1, 3, 8, 7
2. Restriction Enzyme Mapping - use any resources to assist you including the hints below. A circular plasmid molecule (12,000 total base pairs in size) was cut with a series of restriction enzymes and the digestions were size fractionated by agarose gel electrophoresis. Some digestions involved just one enzyme (single digest), some combinations of two enzymes (double digests), and one utilized all three enzymes (triple digest). Agarose gel electrophoresis of the digestions produced bands of the following sizes. Enzyme EcoRI Hindi!! Pstl EcoRI and Hindill EcoRI and Psti Hindill and Pstl EcoRI, Hindill, and Pst I Bands of the Agarose Gel (size in base pairs) 2300 and 9700 4000 and 8000 12,000 800, 1500, 2500, and 7200 2300, 3200, and 6500 4000 800, 1500, 2500, 3200, and 4000 I Draw a plasmid map showing the location of the restriction enzyme sites relative to each other for each map. Include all 7 maps in your answer.
9. The restriction site sequence for the restriction enzyme Sau3Al and BamHI include four identical bases, making their sticky ends identical as shown in the figure. Let's say you have foreign DNA whose flanking regions were cut with Sau3AI. Also, you want to use a plasmid containing a BamHI restriction site. (1) Would it be possible to ligate the foreign DNA into the BamHI site of the plasmid? Explain. lison Lenharc (2) Would it be possible to cut the ligated sites with Sau3AI? What about BamHI? What problems will you expect if you use BamHI? BamHI Sau3Al G-G-A-T-C-C பர்டிய C-C-T-A-G-G G-A-T-C Hi- 目1目 C-T-A-G C-C-T-A-G C-T-A-G G-A-T-C-C E E G-A-T-C= 10. An ampicillin-resistant, tetracycline-resistant plasmid, pBR322, is cut with Pstl, which cleaves within the ampi resistance gene. The cut plasmid is ligated with Pstl digested Drosophila DNA to prepare a genomic library, and t rcoli K12