QUESTION 1 The relative amounts of each nucleotide base are tabulated below for four different viruses. Virus T CUG A 1 34 42 0 18 39 || III 0 24 35 27 17 0 12 9 12 9 IV 23 16 0 16 23 For each virus, indicate whether its genetic material is DNA vs. RNA and double-stranded vs. single-stranded by putting the correct letter in the box next to each virus. Every choice will be used once and only once. Virus I: Virus II: Virus III: Virus IV: a. Single-stranded DNA b. Double-stranded DNA c. Single-stranded RNA d. Double-stranded RNA

QUESTION 1 The relative amounts of each nucleotide base are tabulated below for four different viruses. Virus T CUG A 1 34 42 0 18 39 || III 0 24 35 27 17 0 12 9 12 9 IV 23 16 0 16 23 For each virus, indicate whether its genetic material is DNA vs. RNA and double-stranded vs. single-stranded by putting the correct letter in the box next to each virus. Every choice will be used once and only once. Virus I: Virus II: Virus III: Virus IV: a. Single-stranded DNA b. Double-stranded DNA c. Single-stranded RNA d. Double-stranded RNA

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Similar questions

35. M Heinz Shuster collected the following data on the base composition Move ANALYSIS ribgrass mosaic virus (H. Shuster, in The Nucleic Acids: Chemistry and Biology, vol. 3, E. Chargaff and J. N. Davidson, Eds. New York: Academic Press, 1955). On the basis of this information, is the hereditary information of the ribgrass mosaic virus RNA or DNA? Is it likely to be single stranded or double stranded? Percentage A T U Ribgrass 29.3 25.8 18.0 0.0 27.0 mosaic virus Leibniz Institute for Age Research, Fritz Lipmann-Institute. Ribgrass mosaic virus.
Question 13 If a recombinant plasmid (below) was obtained inserting DNA into the BamHI site, screening for the recombinant plasmid can be done by which of the following technique? A) Plate on agar plates containing tetracycline and ampicillin. (B) Plate on agar plates containing ampicillin, C) Plate the cells on agar containing ampicillin then surviving colonies are plated on another agar plates with tetracycline. D) Plate on agar plates containing tetracycline. Pal Pord- ampr EcoRI ПРИ Ano pBR322 (4363 bases) Prull BamHI Sall let" Aval -Sall
ntrol A option N S X H command C V G B I N M command ? ?? option Name four differences in the structure and location of DNA VS RNA
Question 39 Where would you find the chromosome of a bacterium? bacteria do not have chromosomes plasmid nucleoid nucleus
Do question 19
b) Among the progeny from the Hfr3 mating above, you find one that has the genotype: Abc de F Draw out the gene transfer and crossover(s) that produced this outcome: c) Among the progeny from the Hfr3 mating above, you find one that has the genotype: A B c d e f Draw out the gene transfer and crossover(s) that produced this outcome:
Question 12 Referring to the pBR322 plasmid below, if a recombinant plasmid were obtained inserting DNA into the BamHI site, the recombinant plasmid would lack which of the following properties? A It would replicate autonomously. B) It would be resistant to the antibiotic ampicillin. C) It would possess at least two promoter sites. (D) It would be resistant to the antibiotic tetracycline. Pul Pod- ampr HIID EcoRI BamHI pBR322 (4363 bases) or Prull let Aval -Sall
Second, Question 2
help me with this multiple choice question please, this is molecular and cell biology Visualization of an electrophoresed agarose gel (D) Plasmid DNA cannot be visualized on an agarose gel (A) Plasmid DNA may be visualized as multiple supercoiled forms (B) Visualized plasmid DNA is always linear Ⓒ(C) Visualized plasmid DNA is always circular
QUESTION 21 What model is currently accepted for DNA replication? O Conservative Model Semi-Dispersive Model O Semi-Conservative Model O Dispersive Model QUESTION 22 Which of the following enzymes replicates DNA? O DNA polymerase O Helicase O Ligase O RNA polymerase QUESTION 23 The lagging strand is svnthesized in:. Click Save and Submit to save and submit. Click Save All Answers to save all answers. Type here to search
Question 2: - selecting PCR primers The sequence shown below is the 5' to 3' strand of a dsDNA template. What are the sequences of the two 18'mer oligonucleotides that you would need as primers for amplifying the underlined region? (Select the binding sites of your chosen primers within the underlined region rather than in the flanking sequence). 5'-AATCCGACCTGATTCTAAAGCGCGCTAAGAGCTACGTAGGCACCCAT GTTGGAAATCTCTTATCGGAGATTTCTTCTTGATTACTGGCCCTATGCAT GTCATTCCATGCCATCGGTATTCTCGATACTTGTACTTGATGCATTCGA-3' Primer 1: 5'- Primer 2: 5'
what analysis can be gathered from the raw count section and also what can also be said for the whole data as a whole. 500 in total please