Imagine you are conducting an Ames test experiment. Based off your results (shown in pictures), answer these questions:1. Generate a fully labeled graph/figure depicting the data generated in lab (minimally you should include the data from control, 2-NF, and two different test compounds.)2. Make a bulleted list of 3 distinct and specific observations/patterns seen in your graph/figure - for each observation, indicate specifically where you should look to find the observation on your figure. Test MaterialNo bacteria2-NF (300 ug/mL) 21/316/8Splenda* (100mg/mL)Pickle JuiceWindexEqual*Grill surfaceNegative control(P/Y)16/8Evape liquidDMSO Extracted8/1618/616/818/6(DMSO extractedfrom kimwipedsurface)White Sugar*10/14Rust (flaked off of 24/0a nail)(DMSO extracted)Listerine15/920/4Tobacco from a 23/1cigarette(DMSO extract)*= assume equal molarity1:10 Test (P/Y) 1:2 Test (P/Y) Test - no dilution (P/Y)21/319/50/248/1616/820/412/1223/124/024/017/623/122/217/716/810/1413/1113/118/1620/411/1324/019/510/1421/39/1512/122/2211/1312/122/2221/313/1124/024/07/18 Control01234SamplePositive Roots0.010.053578DH2345105678910111213141516171819 2320212223241112131415161718192021212221242358911121315161718191920212222232424240.0019111214151617181920212222232424Use these numbers to evaluate mutagenicity in 24-wellplate Ames test format. The numbers listed are thenumber of vellow wells in an given quadrant. Theleftmost numbers are the number of yellow wells yousee in your negative control (i.e., no mutagen added)quadrant.The other numbers are the number of vellow wells vouwould need to see in your sample wells if your addedchemical was mutagenic. For example, if you see 2yellow wells in your negative control quadrant, youwould need to see 7 or more yellow wells in a testquadrant to convince yourself (with a p-value of lessthan 0.05) that mutation rate was above background inyour test sample.

The Ames test is a broadly utilized strategy that uses microscopic organisms to test whether a given…

Imagine you are conducting an Ames test experiment. Based off your results (shown in pictures), answer these questions: 1. Generate a fully labeled graph/figure depicting the data generated in lab (minimally you should include the data from control, 2-NF, and two different test compounds.) 2. Make a bulleted list of 3 distinct and specific observations/patterns seen in your graph/figure - for each observation, indicate specifically where you should look to find the observation on your figure.

Imagine you are conducting an Ames test experiment. Based off your results (shown in pictures), answer these questions: 1. Generate a fully labeled graph/figure depicting the data generated in lab (minimally you should include the data from control, 2-NF, and two different test compounds.) 2. Make a bulleted list of 3 distinct and specific observations/patterns seen in your graph/figure - for each observation, indicate specifically where you should look to find the observation on your figure.

Essentials Health Info Management Principles/Practices

4th Edition

ISBN:9780357191651

Author:Bowie

Publisher:Bowie

Chapter7: Numbering & Filing Systems And Record Storage & Circulation

Section7.2: Filing Systems

Problem 2E

See similar textbooks

Similar questions

10- 00 O SCNSA-SCN10A CDKN1A HANDI VTI1A SYTI • MYOCD 9 10 11 12 13 14 15 16 17 18 19 20 2122 X Y
Following is the data and notice that it is a terrible idea to culture hMSCs longer than 10 days. You’re strongly Days # cells0 50001 75002 125003 125004 218005 287006 530007 1143008 1653009 19200010 19200011 11680012 8950013 8830014 78300 Part1 You are working for a start-up that is pursuing a clinical trial. The trial involves grafting hMSCs intopatients suffering from interveterbral disc disease using a degradable polymer scaffold. You are going to 3Dprint a porous cylindrical scaffold that is 2 cm in radius and 1 cm in height (matching the dimensions of adegenerated disc). Assume a porosity of 50%. You will fill available volume of the scaffold with hMSCs at adensity of 1 million cells per cm3. Based on the data above, what starting number of cells will you use andhow long will it take you to get enough cells for the trial? Part2The trial is a failure (patients did not report any reduction in back pain). Your team wants to try againusing 85% hMSCs and 15% nucleus pulposus cells .…
The sequence shown in Figure 2 is the nucleotide sequence of a heat shock protein of Bacillus anthracis obtained from the NCBI database. >NC_005945.1:2107825-2108262 Bacillus anthracis str. Sterne chromosome ATGCGTAATTTATTTCCAGAAATAACAAAACGTCAAAATGGTATTTTTGATTTTGGACCTTCTTTATTAG AAGGGATGACAGATGCTTTCTTTAAACCGATGAACATGGATATTTTTAAAGTAGATGTTCATGAACAATC TGATAAATATACAGTGAAAGCAGATTTACCAGGTTTTCAAAAAGAAAACATTCAAGTTGAATTTGAACAA GATGTATTAACGATTCAAGCAACTAATCATAATGAAGTAGAAGAAAAAAATGAGAATGGCACATATATTC GTAAAGAACGTTCTATAGGTTCTGTAACTCGACGTTTTAGTTTTAAACAAGTTGAGGAAGAAAATGTTAG AGCGAATTACAAAGATGGCGTGTTGACAATTGAATTGCCAAAATTGAAAGAAGAAAAAAACAGTAAAACA ACAATTAATATTGAATAA Figure 2 (i) Is the nucleotide sequence above translatable into a complete protein? Justify your answer. (ii) Is the sequence above represented in the standard FASTA format? Explain your answer.
Elaborate on the abbreviation RTP. What does it stand for? What is it usedfor?
ocument/d/1J-wo90GpYsd_jQSUBtDQHWisqGvSOteUQYoXaXazyS0/edit uction to cell.. R 1 Summary of Philo... E Petrona Andres Mig.. 2 Translations IXL: Par... IXL - Translations: g.. 1 IXL- meostasis Lab Exercise Tools Add-ons Help Last edit was 2 days ago text Calibri 12 BIU Conclusion: 1. List the changes you observed in the body color and perspiration level in response to? 2. Explain how the changes help the body adjust to maintain equilibrium (homeostasis)? 3. Speculate why a change in body temperature occurs? 4. Name which mechanisms your body uses to maintain a constant body temperature? 5. Explain why an increased breathing rate accompanies exercise? 6. Explain why an increased heart rate accompanies exercise? 7. Write a paragraph about the conclusions you can draw about your body's ability to maintain equilibrium (homeostasis). Be sure to include the answers to the questions above.
Search (Option + Q) rences Review View Help Editing v A^ Dv A A A Question 1 During nucleic acid hybridization, the probe is labelled for DNA stability to increase probe-test DNA binding to identify the location of probe and the test DNA binding for amplification Question 2 10 IV 12 13 14 Which of the following best describes the trait in the pedigree? Question 2 options: X-linked dominant X-linked recessive autosomal domiant autosomal recessive
https://nj.pbslearningmedia.org/resource/nsn08.sci.life.stru.stemcell2/stem-cells-breakthrough/ How could stem cells be used to treat diseases?
Agrobacterium tumefaciens is ... Question 61 options: a family of transposable elements found in maize (corn) that has been introduced into soybeans to improve yields. a naturally occurring bacterium that transfers DNA into plant cells, which researchers have modified into a tool for creating transgenic plants. a genetically modified tomato that has an increased shelf life. a bacteriophage (virus that infects bacteria) that can be used to silence the expression of specific target genes.
Which letter represents the target site of furosemide (Lasix)? E- -B
ule_2023_Spring_Stu x M Inbox (1) - Ic21-0506@lclari X =6104_EP#6 - Google Docs ent/d/104sNODGApfrUg768nDS9piPmOB-VzXs86b_t-tDcDF8/edit My Drive - Google... WebAdvisor Main... ols Extensions Zotero Help text T Arial Haplontic life cycle Diplontic life cycle Parthenogenesis Karyotype Histone - 11 + 2 4. Match the words with the correct definitions: | Alternation of generations Job Listing - USF... WT Enrollment Requir... B I U 3 4 X 0 Lecture Video: The Cell Cyc x Chemical Principl... UO UND Orn Z = - 1:3 A type of reproduction that produces a clone of the mother A protein DNA wraps around it to condense the DNA An organism alternates between 1n and 2n with each generation A complete set of chromosomes, as they appear in the nucleus When an organism spends most of its life in the 1n state When an organism spends most of its life in the 2n state 11
personal/eenongen_my_tnstate_edu/_layouts/15/doc.aspx?sourcedoc={a6b083c9-a226-4c31... O Search (Option + Q) Review View Help Editing v A BI U Ov =<=v 三 v ... Question 13 Zinc finger nuclease is a Gene editing tool: which uses a site-specific endonucleases containing a DNA-cleavage domain and a modular DNA-binding domain RNA-guided endonucleases programmable nucleases Exonuclease Question 14 Which elements are required for DNA to behave as a chromosome in yeast cells: a centromere an autonomous replicating sequence two telomeres Antibiotic selection marker Question 15 A series of such clones where the insert of each clone partially overlaps that of its neighbors with no gaps is known as a Clone Contig DNA fingerprinting A tiling path Genome MacBook Pro
I need help with the following question I dont understand a) and b)!!!!! Dr. Sharon Martin and her company have spent years working to identify how the gene for albinism works. The mutation in this gene causes no pigment to be produced in the hair, skin or eyes. Identifying the gene would open the door to curing the condition. Finally, her team succeeds. But, the years of research have been expensive. One way to make back the money is to patent the gene that the team members have identified. Then, anyone who wanted to develop either treatments or tests would have to pay a fee to use the gene. a) Do you think the government should allow this gene to be patented? Explain. b) If Dr. Martin’s company develops a test for this gene, should they be allowed to patent the test? Explain.