Human Anatomy & Physiology (11th Edition)
11th Edition
ISBN: 9780134580999
Author: Elaine N. Marieb, Katja N. Hoehn
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
If you want to engineer a cytoplasmic protein to become a peroxisomal protein, which of the following amino acid sequences would you need to add?
A signal sequence to its N-terminus and a KDEL sequence to its C-terminus
An SKL sequence to its C-terminus
A signal sequence to its C-terminus and a KDEL sequence to its N-terminus A signal sequence to its N-terminus and an SKL sequence to its C-terminus
A KDEL sequence to its C-terminus Expert Solution
This question has been solved!
Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.
This is a popular solution
Trending nowThis is a popular solution!
Step by stepSolved in 3 steps
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Assume the first nucleotide in the sequence is at the +1 position. Transcribe the DNA sequence into mRNA and then translate it into the polypeptide. Give the polypeptide sequence in the following form: Met-Thr-Trp-Tyr-Val etc. 5' ACCGAAGGACTTATGGAGCGCTCATGATTTGCT 3'arrow_forwardSequence 1 : TACGCTACGGTAATC Sequence 2: TACGCTACTATCGTAarrow_forwardMatch the following with what organelle (one per blank) it is designated to go (letters can be used once, twice or not all): A. Lysosome B. Golgi body C. Endoplasmic reticulum mRNA transcript has a KDEL (amino acid code). protein is N- glycosylated protein has a mannose-6-phosphate sugar D. Nucleus MRNA a transcript has a long string of hydrophobic amino acids E. Peroxisome MRNA transcript encodes for a string of basic amino acidsarrow_forward
- I need an example to study for an testarrow_forwardIn your own wordsarrow_forwardThe synthesis of a protein requires that the amino acids that constitute the growing polypeptide chain be covalently linked to the amino acid attached to the tRNA at the aminoacyl site of the ribosome. Which of the following catalyses this reaction? Options: the aminoacyl tRNA synthetase eEF2 eEF1-GTP a large ribosomal RNA the initiator tRNA metarrow_forward
- Write the standard base sequence of the messenger RNA that would cause a ribosome to make the following peptide: Met-Val-Asn-Tyr-Tyrarrow_forwardAn anticodon of tRNA has the sequence GCA. What amino acid does this tRNA carry? HINT: you use mRNA codons to read the genetic code chart.arrow_forwardGenetic expression involves transcription and translation. Match the structure or molecule to the step site where amino acid combines with tRNA intron sequences are removed and exons are combined together makes RNA more stable in the cytoplasm region of DNA with sequences that combine with RNA polymerase transcribed strand that will go on to translation connects amino acid to polypeptide chain and leaves tRNA site where tRNA with amino acid enters the ribosome recognized by the protein synthesis machinery enzyme that connects RNA nucleotides to DNA template part of tRNA with nucleotides complementary to mRNA 1. peptide bond 2. 3. antisense strand 4. anticodon loop 5. RNA polymerase 5' cap 6. A site 8. 7. splicing 9. promoter region acceptor stem 10. poly-A tailarrow_forward
- Name the protein structural element shown in yellow in the figure: B-barrel reverse turn disordered region a-helix parallel ß sheetarrow_forwardThe figure below shows a ribosome in the process of translating an mRNA with a sequence: 5'...AUGCCGUAUGCUCUUUAA..3' a) The right side shows the ribosome with an empty A site aligned with the codon 5'UAU3'. The next tRNA to occupy the A site on the ribosome will have what anti-codon sequence (label 5' and 3')? Keep in mind the wobble pairing rules and make sure your answer is consistent with the genetic code. Explain your answer. b) Suppose, just as the ribosome started translating the mRNA, the cell suddenly lost all of its alanine tRNAs. Using the figure as a guide, draw and label the state the ribosome would arrest in.arrow_forwardA signal sequence or the translocation of a protein can be genetically characterized. Please design an experiment to identify a signal sequence in a protein. This signal sequence should allow the transferring of the protein into a particular organelle, for example, the nucleus.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education