Q: Give the base sequence of the complementary DNA strand of the DNA chain with the following base…
A: DNA is a macromolecule composed of individual subunits known as nucleotides. Each nucleotide…
Q: If one strand of DNA has a sequence of TCAG, then the sequence of bases on the complementary strand…
A: DNA is double stranded where the two strands are antiparallel and follows complementary base…
Q: If the DNA has a triplet code of CAG in one strand. What is the complementary triplet code in the…
A: Please post MCQ's as separate questions.
Q: ou are given a segment of DNA : 5’ - CATGTCAAC – 3’ What is the complimentary strand?
A: Adenine in DNA always pairs with Thymine and cytosine always pairs with Guanine and vice versa .…
Q: If the sequence of a gene is: 3'TACATACCAACTGAGGATCGC5' 5'ATGTATGGTTGACTCCTAGCG3' And the RNA…
A: DNA is a double stranded helical structure found generally in Eukaryotes and prokaryotes while in…
Q: A double-stranded molecule of B DNA contains 340 nucleotides. How many complete turns occur in this…
A: DNA duplex model proposed by Watson and Crick is right-handedly coiled and is called B-DNA. A DNA…
Q: Give the DNA compliment to the following DNA strand. GTA SMH UUU GUA CAT
A: In DNA replication, the rule of complementarity is as follows- 1. Adenine (A) and Thymine (T) are…
Q: Which nucleotide is most non-polar and why? What structural element of DNA gets cleaved by…
A: The monomeric units of nucleic acids are called nucleotides. Nucleotides are generally…
Q: Which strand was used to form the following amino acid. strand 3 "ATGGAATGTTTACCCGTATTATACGGATAGACG…
A: The four bases of DNA—the A, C, G, and Ts—are strung together in such a way that the cellular…
Q: If one DNA strand is 5′–GATTCGTTC–3′, what is the complementary strand?
A: Complementarity in the strands of DNA is referred to as a lock-and-key relationship between both the…
Q: What sequence of bases on one strand of DNA (reading in the 3′ to 5′ direction) is complementary to…
A: DNA (Deoxyribonucleic Acid) It is defined as a genetic material that has all the stored genetic…
Q: One DNA strand has the sequence 5' -ATTCCGTAGC-3' what is the complementary strand sequence?
A: DNA ( Deoxyribonucleic acid ) is two stranded structure which act as genetic material in most of the…
Q: 10
A: DNA replication is a process by which new copy of DNA molecules are made by DNA polymerase.
Q: Which of the following would be the correct complementary sequence to this strand of DNA: 5 ATTCGATC…
A: Question- Which of the following would be the correct complementary sequence to the strand of DNA…
Q: One strand of a double-helical DNA has the sequence (5’)GCTCAATATTTCTCAAAAT ATTGCGC(3’). Write the…
A: The central dogma of molecular biology is the metabolic process in which the double-helical…
Q: How are ‘Sticky ends’ formed on a DNA strand? Why are these so-called?
A: A restriction endonucleases are an enzyme that can cut the DNA into different fragments at sites…
Q: Which strand of DNA is the template strand, and which is the informational strand?
A: Deoxyribonucleic acid (DNA) was a molecule which was composed of polynucleotide chain and it was…
Q: Two highly negatively charged complementary strands of DNA come together to form a double helix.…
A: Deoxyribonucleic acid (DNA) is the nucleic acid which contains the hereditary information that is…
Q: What is the difference between a template strand and adaughter strand of DNA?
A: DNA replication is a process that involves the formation of a new identical DNA strand from an…
Q: If the sequence T-A-C-C-C-T appears on the informational strand of DNA, what sequence appears…
A: DNA is a deoxyribose sugar nucleic acid that carries genetic information from one generation to…
Q: One strand of a DNA helix has the sequence: 5'-ATTGCCGTC-3'. Write the sequence of its complementary…
A: A DNA helix is an antiparallel helix that is wound on each other. It consists of two complementary…
Q: Which strand was used for the following old amino acid. strand 3 "ATGGAATGTTTACCCGTATTATACGGATAGACG…
A: By the process of transcription mRNA is produced from the DNA. the transcription process occurs…
Q: If one DNA segment has the following base composition, 5'-CAGTTAGTCA-3', which of the following…
A: The nitrogenous bases of two polynucleotides in a DNA molecule are linked through hydrogen bonds…
Q: If this sequence of bases was on one side of a DNA moléčulé, whát wõuld be on the opposite side?…
A: The answer is TTTAGCC. The last option.
Q: In a double-stranded, B-form DNA, how many nucleotide bases can be found in 3 turns of the double…
A: Watson and Crick first described the structure of the DNA double helix in 1953 using X-ray…
Q: In NOT more than 200 words, explain how the double-helical structure of DNA suggests a mechanism for…
A: DNA replication: It is a process of producing two identical replicas of DNA for one original DNA.
Q: Question mentioned in the attachment
A: B form of DNA is considered a right-handed double helix DNA. It tends to runs in opposite directions…
Q: given double stranded DNA undergoes enzymatic hydrolysis targeting only the "b" side in the…
A: Introduction The DNA helix acts as a template for its own duplication. Because the nucleotide A will…
Q: What would be the amino acid sequence coded for by the template strand of the DNA molecule above?
A: The complementary strand or coding strands codes for amino acid in protein synthesis. The…
Q: If one strand of the DNA double helix consists of T-C-G-A-T-G-T-A, what is the sequence of the…
A: Introduction DNA ( Deoxyribonucleic acid) and RNA( ribose nucleic acid). These are the nucleic acids…
Q: If a DNA strand has the nucleotide sequence of CCGAGATTG, what is the nucleotide sequence of the…
A:
Q: From which end of a strand of nucleic acid does DNA polymerase I REMOVE nucleotides? A) 5' B) 3'…
A: DNA polymerase 1 has three types of polymerase activity. 1. 5'-3' polymerase activity- It is…
Q: As the minor and major grooves wind around a DNA double helix,do they ever intersect each other, or…
A: DNA full form is deoxyribonucleic acid. DNA is the main constituent of the chromosome. It contains…
Q: The two strands of a DNA double helix can be separated by heating. If you raise the temperature of a…
A: A double-stranded DNA is joined together by a bond and seems to be a twisted ladder. Which is…
Q: Explain, If the template strand of a DNA is 3’-ATCATG-5’, what will be the complementary strand?
A: The DNA or deoxyribonucleic acid is the genetic material of all the living organisms and it is…
Q: What is the term applied to the trinucleotide shown by the arrow? 5' AU Ру AGGCC G C G G G ACCACCUGe…
A: This a structure of tRNA, The tRNA molecule has a distinctive folded structure with three hairpin…
Q: in DNA replication, if the template strand is 5’-ATCCGTGTAACCTT-3’, what is the sequence of the…
A: DNA strand is made up of 4 nitrogenous bases i.e adanine, thymine, guanine & cytosine.
Q: he sequence of the DNA template strand is 3’– GACTTCC – 5’ What is the sequence of the DNA…
A: DNA (Deoxyribonucleic Acid) It is defined as a genetic material which has all the stored genetic…
Q: Given the following DNA sequence: 5’-ATGCGGCCAAGGTCAGAGTGACA-3’ a) If this DNA strand represents…
A: Given the following DNA sequence: 5’-ATGCGGCCAAGGTCAGAGTGACA-3’ a) Sense strand is also known as…
Q: What is the melting temp. of the following double-stranded DNA fragment…
A: Melting temperature of the DNA is the temperature at which half of the DNA becomes single stranded…
Q: A double-stranded DNA molecule contains 560 nucleotides. Howmany complete turns occur in this double…
A: Deoxyribonucleic acid (DNA) is a double-stranded molecule. DNA replication is the process by which…
Q: If the base sequence on one DNA strand is ATGGCCTAG, what is the sequence on the other strand of the…
A: In order to make the complementary strand we have to look on following things:- DNA → DNA adenine →…
Q: What is the complimentary DNA sequence to the strand below? C-G-G-T-T-A-G
A: Deoxyribonucleic acid (DNA) is a double-stranded molecule. DNA replication is the process by which…
Q: If a double-stranded DNA molecule is 22% G, what is the percentage of A, T, and C? Explain.
A: Chargaff rule states that DNA from any species of any organism should have a 1:1 stoichiometric…
Q: Given a sequence of a DNA coding strand: 5’-ATGATTATCCTATAG-3’ What is the sequence and…
A: The complementary DNA sequence of DNA coding strand ATGATTATCCTATAG is TACTAATAGGATATC.
Q: If the sequence of base pairs on a DNA molecule are AGATTAGTG, what is the sequence on the…
A: Deoxyribonucleic acid (DNA) is a molecule made up of two polynucleotide chains that coil around each…
Q: What does it mean when we say that the two DNA strands in thedouble helix are antiparallel? What…
A: Deoxy ribonucleic acid (DNA) is the genetic material of most organisms that carry coded genetic…
Q: How would the uniform 2 nm diameter of DNA be affected iftwo purines or two pyrimidines could pair…
A: DNA is called deoxyribonucleic acid. DNA is found in the genome of most of the organism. DNA stores…
Q: The nucleotide sequence of one DNA strand of a DNA double helix is 5’-GGATTTTTGTCCACAATCA-3’.What is…
A: Introduction DNA is an organic molecule that includes genetic information as well as instructions…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- What is the importance of complementary base pairing to DNA replication?The DNA STRAND IS 3’ TAC-AGC-ACT-CAG-TCA 5’ and Non-template strand = 5' - ATG-TCG-TGA-GTC-AGT - 3' . If on the non-coding strand of DNA there is suddenly one T base that sneaks into the 4th sequence (from the left), or causes a mutation, then how will the RNA be formed and the chain arrangement of the amino acids produced by this mutation? 4th sequence (from the left) should be = TCG right?The DNA STRAND IS 3’ TAC-AGC-ACT-CAG-TCA 5’, and Non-template strand = 5' - ATGTCGTGAGTCAGT - 3' . If on the non-coding strand of DNA there is suddenly one T base that sneaks into the 4th sequence (from the left), or causes a mutation, then how will the RNA be formed and the chain arrangement of the amino acids produced by this mutation?
- If the sequence of one strand of a DNA molecule is 5’-AGCCCCGACTCTATTC-3’, what is the sequence of the complementary strand?What is the nucleotide sequence of the DNA strand that is complementary to 5'-GGCGCAACTGTCACAA-3'?Here is a DNA coding strand’s sequence and direction: 5’-ATGCCGATATAG-3’ . What would be the amino acid sequence in the polypeptide encoded by this DNA?
- in DNA replication, if the template strand is 5’-ATCCGTGTAACCTT-3’, what is the sequence of the newly synthesized DNA strand? Write the sequence from 5’ to 3’.What is the nucleotide sequence of the complementary strand of the DNA molecule: 5’-AATGCGATCTTCAT-3’? Indicate the 5’ and 3’ ends. Follow the same format as the given sequence.If the DNA sequence A-T-T-G-G-C-C-T-A on an informational strand mutated and became A-C-T-G-G-C-C-T-A, what effect would the mutation have on the sequence of the protein produced?
- Given this sequence (of course the DNA is double stranded, but I’m only showing one strand), will it tend to cause a deletion to form, or an inversion? Diagram how it (either the deletion or inversion) will happen. xxxxxxxcatatgctttcag (another five hundred or so letters) catatgctttcagxxxxxxxxx Ditto, using this sequence xxxxxxxxcatatgctttcag (another five hundred or so letters) gactttcgtatacxxxxxxxxxxxWrite the complementary strand to the following single-stranded DNA and label the 5' and 3' ends: 5'-ATAGCATGGGCCATACGATTACTGA-3'Since the sugars and phosphates are the same on a DNA strand, we represent the strand with the nitrogen bases. If the first strand of DNA is AGCTGCAAT, what would be the nitrogen base sequence of the second strand?
