Give the base sequence of the complementary DNA strand of the DNA chain with the following base sequence: 5’ ACGTAG 3’
Q: Illustrate the biochemical pathways for one complete cycle of b-oxidation of fatty acyl CoA (giving…
A: Beta oxidation is a biochemical process in eokaryotes by which fatty acids broken down in cytosol.…
Q: A glucogenic amino acid is defined as an amino acid that can be produced from glucose catabolism O…
A: Depending upon the process of degradation of amino acid, they can be classified into 2 categories:…
Q: Which out of the following statements is true about the regulation of metabolic pathway? a) Most of…
A: The metabolic pathway involves a series of interconnected chemical reactions occurring in the cell.…
Q: What is the Reverse transcriptase (RT) inhibitors? Explain with an example and describe its…
A: Question 1: Introduction: Reverse transcriptase (RT), also known as RNA-dependent DNA polymerase,…
Q: What is the committed step in the synthesis of nucleotides? Synthesis of phosphoribosylpyrophosphate…
A: Nucleotide synthesis occurs by two different processes from purine Nucleotide synthesis and…
Q: List the 6 assumptions by Henri and Michaelis-Menten in describing the relationship between initial…
A: Victor Henri was the first one who tried to relate the velocity or rate of an enzyme catalyzed…
Q: Which of the following is NOT a regulatory mechanism for digestion? Only carbohydrates are digested…
A: Introduction: The process by which our body breaks down food into small nutrient molecules is known…
Q: 1A. The pyruvate dehydrogenase complex is heavily regulated as the nexus between glycolysis and the…
A: "Since you have asked multiple subparts of a questions, we will solve the first two subparts of the…
Q: CI The common name for metabolite 4 How does its structure differ from diazepam? HO НО Metabolite 4…
A: The distinctive chemical structure of molecules that are used as drugs gives them their…
Q: UV light causes the conversion of a dietary form of vitamin D into vitamin D3 True O False
A: Vitamin D is the sunshine vitamin. Sun induced vitamin D synthesis is greatly influenced by season,…
Q: Complete the pathway below by writing the intermediate (I) name, pathway name (P) and enzyme (E)…
A: Pyruvate molecules produced as the end product of the glycolytic pathway enter into the citric acid…
Q: Lipid anchor is myristic acid and linked to a glycine…
A: Introduction: Lipids are a heterogeneous class of compounds that are insoluble in water and…
Q: A new virus has recently been discovered that infects human lymphocytes. The virus can be grown in…
A: Viruses are of two types based on their genetic material present inside their protein capsid. DNA…
Q: Use the table below to identify the oil sample being described/ asked. Oil sample % Fatty acid by…
A: Unsaturated fatty acids are the fatty acids with one or more double bonds. Iodine is a halogen that…
Q: In vision, vitamin A serves as a cofactor for key enzymatic reactions needed for vision is…
A: Rods (in the periphery) and cones (in the center) make up the eye's retina. Cones are essential for…
Q: Cancer stem cells (CSCs) are cancer cells (found within tumors or hematological cancers) that…
A: Cancer stem cells are the ones that are ones that have the ability to self renew malignant as well…
Q: The base that is circled in red could be adenine thymine guanine None of the provided answer choices…
A: The molecular basis of heredity is DNA. It can be thought of as a genetic information reserve bank.…
Q: Draw the structure of triglyceride containing the fatty acids palmitic, oleic, and linoleic. How…
A: Triglycerides typically made of a glycerol backbone along with three fatty acids bonded to the…
Q: Which of the following is NOT a fate of pyruvate in metabolism? . Conversion to alanine as its…
A: Pyruvate is the end product of glycolysis that occurs in the cytoplasm of the cell. Pyruvate…
Q: Cholesterol is An essential lipid molecule we can only obtain by ingestion O An essential lipid…
A: Cholesterol is a neutral lipid. It is a type of sterol. It is plays very important in the body by…
Q: Benzodiazepines bind to GABAa receptors and increase the effects of GABA. Which effect would you…
A: Gamma-aminobutyric acid or GABA is the inhibitory neurotransmitter of central nervous system. It…
Q: You are trying to confirm that an enzyme you are studying has the following amino acid in its active…
A: Covalent modifications of amino acids involves the addition or removal of chemical groups to the…
Q: 1. Bradykinin peptide: a) The sequence of the gene that encoded it, indicating with different…
A: As per guidelines, we are author to answer only first-three sub parts of first question only.…
Q: Which of the following type of metabolites is used for generating glucose under severe starvation…
A: Metabolism : It is process of breakdown (catabolism) and synthesis (anabolism) of biomolecules in…
Q: Which items or conditions improve iron absorption in the mammalian gut O vitamin C O compounds in…
A: Iron is the most vital component of Hemoglobin which is present in blood. Hemoglobin is a type of…
Q: How many total moles of ATP are created in a cell with an ATP synthase with 8 c subunits for every…
A: Glucose is broken down into 2 molecules of pyruvate through glycolysis in the cytoplasm. Pyruvate is…
Q: Consider the mRNA sequence below. Assume that the following mRNA segment has been translated.…
A: Given mRNA sequence is 5'-GCAAGUCUUAAU-3'. Ans 1. Three consecutive nucleotide codons translate into…
Q: ALL biosynthetic reactions require which of the following metabolites(s)? NADPH Glucose 6-P High…
A: Biosynthetic reactions are the reactions that are catalysed by Enzymes to synthesise more complex…
Q: Question #9 In the kidney the malate:aspartate shuttle is the only system that transports the…
A: The main function of the malate aspartate shuttle is to perform the trasnportation of NADH. This…
Q: Which syndrome is most closely associated with gluten sensitivity?
A: Gluten is a protein that can be found in a variety of grains, including wheat, rye, spelt, and…
Q: Match lipid descriptions in column A with the phospholipid type in column B ✓ H is attached to the…
A: Membrane is composed of phospholipids whose structure has polar head group & non-polar tails.…
Q: What characterizes the C5 amino acids? These amino acids are converted to glutamate then deaminated…
A: Amino acid metabolism is divided into pathways based on the lengths of carbon structures involved.…
Q: The catalytic mechanism of bovine pancreatic RNase A relies upon acid-base catalysis involving the…
A: Bovine pancreatic RNase is a nuclease Enzyme that catalyses the cleavage of RNA. The protein…
Q: State whether the gene is up- or down-regulated and briefly explain the reason behind. The…
A: A polypeptide is composed of twenty standard amino acids. These twenty standard amino acids are…
Q: CH3CO-ETATKAELLAKYEATHK-CONH2 4. A polypeptide comprised of 17 amino acid res- idues with the…
A: Polypeptide: These are chains of amino acids with peptide bonds that connect them. Dehydration of…
Q: All of the following are considered “weak” interactions in proteins, except: a. hydrogen bonds. b.…
A: Proteins are biomolecules with different levels of conformation. Primary, secondary, tertiary, and…
Q: The human embryo and the embryos of other animals with backbones have gill slits. According to the…
A: The human embryo and embyos of other animals with with backbones have gill slits. Pharyngeal gill…
Q: Which of the following mutagens can substitute bases in DNA because of structural similarity?…
A: Mutagens are the chemical substances that can alter the DNA sequence and cause Mutations.
Q: Which of the following ligands is an example of an ambidentate ligand? nitrite, NO₂ chloride, Cl…
A: A type of ligand that is capable of sharing one pair of electrons, is referred to as a monodentate…
Q: Please, explain and write about what type of evidence, biochemically, led to the cyclic nature of…
A: The glyoxylate cycle is an anabolic mechanism found in fungus, bacteria, plants, protists, and…
Q: . Comment on the issue's potential benefits detriments to global health using therapy.
A: Global health is a field of study, research, and application that focuses on improving health and…
Q: Which of the following is a common intermediate in both carbohydrate and lipid catabolism, leading…
A: Carbohydrates are the primary source of energy for the body. The excess carbohydrates are stored as…
Q: A student Hussein woke up early and then went quickly - without having breakfast - to Al-Maaqal…
A: Glucose is a very important source of energy & it is required by our body to carry out normal…
Q: f the following statements is/are FALSE? aramagnetic metal ions can have an odd number of electrons.…
A: The crystal field theory is used for giving the description of the metal-ligand bond. The…
Q: What characterizes the C5 amino acids? These amino acids are converted to glutamate then deaminated…
A: Introduction: Amino acids are compounds that contain an amino group, a carboxyl group, and a side…
Q: An enzyme with a high turnover number has A. a high Kcat. B. a low Km. C. a high Vmax. D. a high…
A: Turnover number = Vmax/[ET] Vmax is maximum velocity of reaction ET is given enzyme concentration
Q: 1. Draw the structure of the following fatty acids: (a) Stearic acid (b) Arachidonic acid 2. Draw…
A: Note : Hi ! Thank you for the question. We are authorized to answer one question at a time. Since…
Q: An average protein will not be denatured by: a. a detergent such as sodium dodecyl sulfate. b.…
A: Protein denaturation disrupts the native structure of the protein i.e. proteins lose their…
Q: 26. Which of the following amino acids can enter directly into the citric acid cycle intermediates?…
A: Note : Hi ! Thank you for the question. We are authorized to answer one question at a time. Since…
Q: What is the predominant 2° structure in this figure? O alpha helix Obeta sheet O gamma-globulin O…
A: Proteins are composed of amino acids. They are linked together by peptide linkages. Proteins have…
Give the base sequence of the complementary DNA strand of the DNA chain with the following base sequence: 5’ ACGTAG 3’
Step by step
Solved in 2 steps
- For the following DNA sequence: 3’–CGATACGGCTATGCCGGCATT–5’ Write: a) the sequence of the complementary DNA strandWrite the sequence of the complementary DNA strand that pairs with each of the following DNA base sequences:(a) TTAGCC(b) AGACATWrite the sequence of the complementary DNA strand thatpairs with each of the following DNA base sequences:(a) GGTTAC(b) CCCGAA
- Here is a DNA coding strand’s sequence and direction: 5’-ATGCCGATATAG-3’ . What would be the amino acid sequence in the polypeptide encoded by this DNA?Write the base sequence and label the 3' and 5' ends of the complementary strand for a segment of DNA with the following base sequences: 5'CGGAC3'There is a chemically synthesized DNA oligonucleotide is 5’–AUCG–3’. Pleasedraw the all-atom structure of this RNA strand, including that of the phosphategroup, the pentose (ribose), and the base for each nucleotide. The structure is inthe 5’→3’ direction
- Write the sequence of reverse compliment chain to this DNA sequence: CGTCCGCCCCGCGAGCACA TGTGCGCGCGGGGCGList the DNA bases that will complementary base pair with the following sequence: A-G-C-T-A-C-GIn the DNA double-helix structure, the larger of the two grooves formed by the helical twist where certain base pairs are exposed is called the:
- What is the nucleotide sequence of the complementary strand of the DNA molecule: 5’-AATGCGATCTTCAT-3’? Indicate the 5’ and 3’ ends. Follow the same format as the given sequence.Write the sequence of the complementary strand of the following portion of a DNA molecule: 5 '–TAGGCTA–3 '.One strand of a double-helical DNA has the sequence (5’)GCTCAATATTTCTCAAAAT ATTGCGC(3’). Write the base sequence of the complementary strand. What special type of sequence is contained in this DNA segment?