If a strand of DNA is GAG  CGT  CTA, what is the sequence of amino acids that will be produced?  (use the codon chart provided above)  a. Leu Ala Asp b. Ser His Lys c. Gly Leu Cys d. Ile Met Thr

Q: Write a possible mRNA sequence that codes for each of the following peptides. a. Met–Arg–His–Phe c.…

A: There are 64 different codons of which sixty-one codon codes for specific amino acids, four…

Q: The source of C8 in adenine is from   A. Glycine   B. Aspartate   C. Glutamine   D. Formate

A: Adenine is a nucleic acid base. It is present in Deoxyribonucleic Acid (DNA) and Ribonucleic Acid…

Q: Glutamic acid (Glu) is encoded by GAA and GAG, while Glutamine (Gln) is encoded only by CAA and CAG.…

A: The base sequence provided in the picture given in the question is CUC as the anti codon which means…

Q: Below is a sequence of mRNA. Use it to answer the questions below. 5' -…

A: The central dogma in both prokaryotic and eukaryotic cell consists of a series of steps including…

Q: You have isolated a new protein called STICKY. You can predict from comparisons with other known…

A: Proteins are essential nutrients for the human body. They are one of the building blocks of body…

Q: What is one current controversy surrounding abortion? Summarize in two paragraphs.

A: One of the most significant controversies surrounding abortion is the debate over when life begins.…

Q: Which of the following base change in the sense strand will result in the alteration of the net…

A: Option (A) TCT codes for - Serine (Polar, but Uncharged) TTA codes for - Phenylalanine (Non polar)…

Q: A segment of a protein-encoding gene sequence is given below. 5’-AAGTTTGGCACT-3’…

A: Transcription is the process by which the genetic information encoded in DNA is copied into a…

Q: Identify the correct mRNA that will be produced from this NON-TEMPLATE or CODING strand: TAG CCG ATG…

A: The coding strand is the DNA strand whose base sequence is similar to its primary transcript (RNA).…

Q: A mutation occurred that changes the sequence of DNA from: 5’ACGTCATGGATAGTGCGTAAACTA3’ to…

A: Mutations are abrupt changes in DNA only one ways has been changed the original DNA.

Q: CONVERT THE FOLLOWING: DNA - ACA AGA CGG TAC TGA mRNA - _______________ tRNA - _______________…

A: Biological macromolecules are large molecules that are necessary for the survival and growth of…

Q: Which protein of ß galactosidase includes a MCS? Alpha fragment 'lac z gene '2lacz gene 'lacz3gene

A: Lac Z gene is found in the MCS. MCS stands for multiple cloning site. This site is responsible for…

Q: Explain why the sequences of these two genes are similar to each other but not identical.

A: Genes are the functional unit of heredity. The genes code for proteins which are vital for growth…

Q: NH, SH NH, он HN C. H,N HN PEPTIDE RNGCSN NH, PEPTIDE AHIKP

A: Trypsin is a serine protease that is found in the digestive system of vertebrates where it…

Q: Write a possible mRNA sequence that codes for each peptide. a. Ile–Met–Lys–Ser–Tyr b.…

A: The genetic code is a series of rules that living cells use to convert information found in genetic…

Q: Which of the following arms of t-RNA is required for recognition of the t-RNA by its proper…

A:

Q: B

A: The plasma membrane of a cell comprises of different kind of proteins.they are mainly categorised…

Q: GENE TABLE 1: WILD-TYPE MC1R GENE (LIGHT COAT-COLOR PHENOTYPE) DNA GAA CAG GTG GTT CCA AAG…

A: The central dogma of life involves the following three steps. Replication: DNA replicates to make…

Q: Following is an mRNA sequence reported in data base. 5’ ACC AGA ATG ACC ATG GCA 3’ a) There are two…

A: Ribonucleic acid (RNA) also contains genetic material but rarely takes part in transferring the…

Q: Write a possible mRNA sequence that codes for each peptide. a. Phe–Phe–Leu–Lys b.…

A: Answer- mRNA serves as the template for the synthesis of proteins. The polypeptides are generated by…

Q: Extracting DNA From Strawberries Is isopropyl alcohol polar or nonpolar? Explain

A: DNA extraction is used to isolate dna molecule from the cells . It helps in removing impurities and…

Q: A portion of an unknown enzyme has the amino acid sequence serine phenylalanine - glutamate -…

A: Gene is the sequence of nucleotides that encode a specific protein.

Q: If the DNA sequence that coded for a codon that was complimentary to the ANTICODON AAU underwent a…

A: A mutation may be a change within the sequence of DNA. Mutations can occur as a result of the term…

Q: The wobble position of codons occurs A. before the 2nd base B. after the ribosome initiates a stop…

A: Question - The wobble position of codons occurs A. before the 2nd base B. after the ribosome…

Q: codons that specify the amino acid Vavne (Val), demonstrating the enet There are Second letter 1U C.…

A: There are 4  codons that specify the amino acid valine, demonstrating the genetic code  is…

Q: you have isolated a new protein called STICKY. you can predict from comparisons with other known…

A: A new protein named "STICKY" is isolated, which possesses a specific region in its structure. These…

Q: 2 1] Amino acids are joined fogether into a protein chain by wfrnich of the following a transfer RNA…

A: Introduction :- Amino acids are the building blocks of proteins. The building blocks of life are…

Q: mutate all of your D-form amino acids in your peptidoglycan peptide side chains to L forms. What…

A: Peptidoglycan is an essential component of bacterial cell walls that provides structural support and…

Q: kle cell hemoglobin DNA ÇACGTAGA CTGAGG ACA ckle cell hemoglobin MRNA ckle cell hemoglobin AA…

A: Sickle cell anaemia is a inherent condition in which red blood cells are abnormally fickle shaped…

Q: Enter the corresponding section of mRNA produced from the following section of DNA template strand:…

A: DNA or Deoxyribonucleic acid is the genetic material for most higher organisms and some viruses. RNA…

Q: What type of cytopathic effect is seen when rabies virus infects a monolayer of cells? O the…

A: The cytopathic effect of the rabies virus on a monolayer of cells is characterized by the formation…

Q: You are given the following template strand of DNA: 5'-CGATTGCGATTGGGCATGG-3' A. Transcribe this…

A: DNA or deoxyribonucleic acid is a polymer of deoxyribonucleotides that join together via a 3'-5'…

Q: Dna sense strand :        5' ATG TTT CAA CGA GGT GTT TGA 3' Dna anti-sense strand: 3' TAC AAA GTT…

A: DNA is the nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid in which…

Q: Pol II is active when its tail is phosphorylated. Which of the following amino acids is present in…

A: Amino acids are biomolecules that are comprised of two functional groups, these are an amino group…

Q: 3’ – TACGGACTGATAGGCCCGCGCATC-5’ a.Complementary Strand: b. Direct Transcript: c. Transcript for…

A: Molecular Biology is the branch of biology that deals with a study of the composition, arrangement,…

Q: Which part of a tRNA molecule acts as an amino acid attachment site?   a. the 5' end   b.…

A: tRNA (transfer ribonucleic acid) molecule escorts amino acids to their correct location in a…

Q: Which amino acids would be expected to produce a similar sickling effect if substituted for Val at…

A: The blood disease Sickle-cell anemia occurs due to a substitution mutation. The mutated form of…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.