Dna sense strand :        5' ATG TTT CAA CGA GGT GTT TGA 3' Dna anti-sense strand: 3' TAC AAA GTT GCT CCA CAA ACT 5'   what is the amino acid sequence for this peptide?

Here is the sequence of a portion of a bacterial gene. The template strand is on the bottom: 5'-ATGCTGCGTGCATGGGATATAGGTAGCACACGTCC-3' 3'-TACGACGCACGTACCC TATATCC ATCGTGTGCAGG-5' Would there be an effect on translation of changing the fourth A in the template strand to a C? If so, what effect? AGA AGG GCA CGA GCC CGC GCG CGG GAC AAC UGC GAA CAA GGG CAC AUCC CUG AAA UUA UUG CUA AUA CUC AGC AGU CCA ÜCA ACA CCC UCC ACC UUC CCG UCG ACG GGA GGC GUA GUC UAC GUG UAA UAG UGA GCU CGU GAU AAU UGU GAG CAG GGU CAU AUU CUU AAG AUG ÚÚÛ CCU ÚČU ACU UGG UAU GUU Ala Arg Asp Asn Cys Glu Gin Gly His lle Leu Lys Met Phe Pro Ser Thr Trp Tyr Val stop A R D G IL K Y V

10- 00 O SCNSA-SCN10A CDKN1A HANDI VTI1A SYTI • MYOCD 9 10 11 12 13 14 15 16 17 18 19 20 2122 X Y

5’ AGGATCAACACCTGTACATGG 3’ 3’ TCCTAGTTGTGGACATGTACC 5’    Label the sense and antisense strands and what direction will the RNA polymerase travel to make the mRNA? Transcribe the DNA into mRNA (Include polarity)and translate the mRNA into a polypeptide chain (Include polarity)