Dna sense strand :        5' ATG TTT CAA CGA GGT GTT TGA 3' Dna anti-sense strand: 3' TAC AAA GTT GCT CCA CAA ACT 5'   what is the amino acid sequence for this peptide?

Q: The arrow in the diagram below indicates the direction of movement of the replication fork. 5' A C B…

A: CENTRAL DOGMA OF LIFE   DNA replicates to form   ↓   DNA undergoes transcription to form   ↓   mRNA…

Q: DNA isolated from Aspergillus has an adenine content of 25%. Based upon this information, what is…

A: It is given that the amount of adenine is 25% in DNA.  We need to find the percentage of guanine

Q: Strand 1: C-G-T-A-T-C-T-C-A-T-A-G-C-TStrand 2 : A-A-A-G-A-T-A-T-C-A-C-C-C-AStrand 3 :…

A: The central dogma of molecular biology is that the DNA first undergoes replication to make a copy of…

Q: C4GUCAGUCAGUCO/ Use the codon chart to determine the following RNA strand in amino acids (Remember…

A: Genetic code The relationship between the sequence of amino acids in a polypeptide chain and…

Q: 9. The following DNA sequences found on the sense strand belong to the same eukaryotic gene:…

A: DNA or Deoxyribonucleic Acid acts as the genetic material of biological entities. It is made up of…

Q: Match the primary sequence to its characteristics/function/fate 1. mostly hydrophobic, interacts…

A: Cell signaling is an essential component in the cell biology. The signal transduction is carried out…

Q: Which process is illustrated in the diagram? Pre-mRNA Exon 1 Lariat Exon 1 BEIN Intron Step 1 Step 2…

A: mRNA splicing is a process by which a newly made precursor messenger (m) RNA transcript is…

Q: Nde I EcoR I Sal I Kpn I BamH I PUST MCS ori Xho 1- Ampe BamH I Kpn I EcoR I BamH I gene W Xhe

A: Introduction  A chemical reaction is a process in which the reactants are converted into a product…

Q: What is the amino acid sequence of the peptide that would be synthesized after transcription and…

A: In this situation, we are entrusted with figuring out the amino acid sequence of the peptide…

Q: VA << < B C Match each letter (A through G) to its description. VD VE VF VG H MAX 20 E A மன்மமும் H…

A: In cell signalling the major substances that involve in signalling cascade are receptor proteins,…

Q: You are interested in the rapid mutation rate of the polymerase of a virus XY, that inserts its…

A: The mutation changes the amino acid at the third position. Specifically, it changed from Glycine…

Q: Which forward are reverse primers will amplify the following sequence by PCR?…

A: As given in the question, forward and reverse primer sequences are to be identified to amplify the…

Q: A C mRNA (Met Gly F GGG AUGCCCACG UAG Which letter indicates the amino end of the growing…

A: A covalent link known as a peptide bond connects the carboxyl group (-COOH) of one amino acid to the…

Q: Examine the following sequence of DNA 3’-CTA – TAC – TTA – CGC – GTA – CAT – GCG – TGA – CCC - ACG –…

A: The central dogma is a metabolic process where the  DNA acts as genetic material and transcripted…

Q: antisense DNA strand?

A: Sense strand: This is the segment of double stranded DNA which runs from 5' to 3' direction. This…

Q: What would be the sequence that the RNA polymerase synthese from the follwing DNA sequence? 5'…

A: Transcription: The process of formation of RNA from the DNA by  action of DNA dependant RNA…

Q: Which process is illustrated in the diagram? Replication Transcription RNA processing Translation…

A: We are given an image of circular double stranded DNA with unwinding of two strands at one point.…

Q: What is the complementary strand to the following nucleic acid sequence? 5’ ATCAGCCG 3’ 5’…

A: DNA or deoxyribonucleic acid is a double helical polynucleotide chain made of monomeric units of…

Q: a. Assume that replication has been initiated at that ORI. Provide the sequence of the primer that…

A: DNA is the genetic material of almost all living organisms. It contains information that is…

Q: 26) The accompanying drawing represents simultaneous transcription and translation in E. coli. The…

A: Protein synthesis takes place in two stages, namely, transcription and translation. Transcription is…

Q: Daughter strand 5' end 5-CH₂ CH₂ s s s OH CH₂ 3′ ÓH TE 3' end 3' end T OH 3 H₂C H₂C H₂C 5' end…

A: The question is asking about the direction of growth of the daughter strand during a synthesis…

Q: Based on the following wild type DNA sequence, indicate if each of the mutations should be…

A: A mutation is a change in a DNA sequence. Mutations can result from DNA copying mistakes made during…

Q: The DNA sequence of the coding strand is shown below; which reading frame most likely codes for a…

A: Start codon in translation is AUG in RNA and ATG in the DNA sequence that codes for methionine amino…

Q: It was discovered that COVID19 RNA is a sense (+) strand. If the RNA sequence that codes for the 5…

A: A sense strand, also known as a coding strand, is a stretch of double-stranded DNA that carries the…

Q: 4 sports = Gly, Val 8 legs = Val, His, lle, Tyr Straight antennae = Ala, lle, lle Start codon = AUG…

A: Introduction AUG(Met) GG(U, C, A, G)(Gly) GU(U, C, A, G)(Val) CA(U, C)(His) AU(U, C, A)(Ile) UA(U,…

Q: 2a. Assume that replication has been initiated at that ORI. Provide the sequence of the primer that…

A: AT GC base pairing: In double stranded DNA, the guanine (G) base on one strand can form three…

Q: Which of the following protospacer adjacent motif sequences would be recognized by Cas9?     GCG…

A: Cas9 stands for CRISPR (clustered regularly interspaced short palindromic repeats) associated…

Q: What is the base sequence of a mRNA strand that is complementary to the DNA sequence 5'-ATCGGATTC-3'…

A: Transcription is the process by which an RNA molecule is synthesized from a DNA template. It is a…

Q: N' C' = Polypeptide X d a b = SRP 5'- = translocator e Which region(s) of polypeptide X would bind…

A: Ribosomes refer to the site where the protein synthesis takes place. It comprises rRNA and protein.…

Q: Provide an mRNA sequence and the protein for the following DNA sequence 5'TCC GGT CAT'3

A: When a cell makes copy of RNA from the piece of  DNA, it is known as transcription. Transcription is…

Q: quizzes/85114/take WebSTAC Dashboard Workday Help | Wa... Home - Workday b Identify the W Second…

A: DNA complementary-CCG ATC TGA GTA TAG CCC  mRNA- GGC UAG ACU CAU AUC GGG

Q: Transcribe an mRNA sequence from this TEMPLATE STRAND of DNA 3' CGTACGTGTATCCCATCC 5' 5'…

A: Translation is the process in which ribosomes in the cytoplasm or endoplasmic reticulum synthesize…

Q: How many different single-nucleotide substitutions* (changing one nucleotide to another) in the DNA…

A: The single nucleotide substitutions that can occur to result in a non-sense mutations are -  i) CAA…

Q: ALL GROUPS HAVE A MUTATION MAKE SURE TO IDENTIFY THEM**

A: A mutation is a change in a DNA sequence. It can result from DNA copying errors made during cell…

Q: у OH ON Replication. OH

A: Molecular biology is a branch of biology that focuses on the study of biological molecules and their…

Q: What are the correct codons of the MRNA from the given DNA strand th needs to be transcribed? *…

A: Sense strand It is also called as the coding strand , plus strand or the non template strand. The…

Q: In which strand is the promoter? 5' TCATGAGATA GCCATGCATA TCTAGTATGT AGGCATCTGA GTTTATATCT CA 3' 3'…

A: Phosphodiester linkages connect DNA strands, which are polymers or chains of deoxynucleoside…

Q: Name each of the processes pictured: 5'

A: protein synthesis ELONGATION PHASE OR PROCESS SPLICING TERMINATION PHASE OR PROCESS

Q: What’s the resulting amino acid sequence? 3’CAG TTA AGC CTC GGT TAC CAG GAT ACG GGA 5’

A: Transcription: Transcription is a process where the DNA is used as a template to synthesize mRNA.…

Q: Here is the sequence of a portion of a bacterial gene. The template strand is on the bottom:…

A: DNA and RNA are are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid…

Q: 5’ AGGATCAACACCTGTACATGG 3’ 3’ TCCTAGTTGTGGACATGTACC 5’    Label the sense and antisense strands…

A: DNA is ladder like , helical structure which have ability to form its own copies via DNA replication…

Q: Which primer would bind to this coding strand as a reverse primer? 5' - ATGGCCAAAT GATTCCCACG…

A: Primers are very short sequences of nucleotides (usually 18 to 22 nucleotides) that play an…

Q: What are the label

A: DNA stands for deoxyribonucleic acid. It acts as the genetic material in most of the living…