Identify possible etiologic agents. (a) Enumerate diagnostic tests for the said etiologic agent and choose the one you will order for your patients.
Q: What is the shorthand notation for a fatty acid that contain 20 carbon atoms and double bonds at…
A: Fatty acids are composed of fat in both our body and our meals. The body breaks down lipids into…
Q: Although exposure to both types of radiation can cause DNA damage, ionizing radiation and UV affect…
A: Ioninzing radiation are those which have higher frequency thereby they have higher energy, so that…
Q: Synthesis of new molecules of deoxyribonucleic acid is the process of A. replication B.…
A: To identify: To identify the name of the process in which synthesis of new molecules of…
Q: Located below is a list of examples of hypotheses. You must critique each hypothesis and assess if…
A: A hypothesis is an assumption that is proposed for so that it can be tested to see if it might be…
Q: 1. Which of these methods will allow cell counting and segregation? a. Flow Cytometry b. Western…
A: Introduction :- Bio-physical techniques or methods are combination of biological and physical…
Q: Question 6 Phospholipid bilayer is a fluid matrix. O True False
A: The lipid bilayer (or phospholipid bilayer) is a thin polar membrane made of two layers of lipid…
Q: Question 34 Which characteristic is shared by a cell membrane and a chylomicron? Both contain…
A: Introduction:- All lipid molecules in cell membranes are amphipathic (or amphiphilic), meaning they…
Q: 7) What are adipocytes? 8) Define the following terms: a. Hydrophobic
A: The cell is the term generally defined to mean that they are a primarily structural and well-stated…
Q: A man feels a shooting pain in his arm, then a thundering in his chest. Realizing that he is in the…
A: Heterologous expression is a process by which a host cell expresses a protein that isn't normally…
Q: Experiment on The Predator-prey Interactions Between Zebrafish and Daphnia 1. Six 1-L beakers were…
A: A small planktonic crustacean is the Daphnia, these are the prey for the predators-zebrafish.
Q: s= length of the tail: Long vs. short, B/b = color of the cat: White vs. Brown. Which of the follow…
A: Genetics is typically described because of the manner that they're the area of the biology involved…
Q: 5) Describe the three areas of focus for reducing cholesterol in the body.
A: Disclaimer: “Since you have asked multiple questions, we will solve the first question for you. If…
Q: NERVOUS TISSUE Complete the following concerning nervous tissue: (page 138) Reminds me of: Sketch a…
A: Introduction The nervous system, also known as the neural system, is a complex network of neurons…
Q: When looking at a stained cell under a high power light microscope, can one distinguish between the…
A: Introduction Chromosomes are threadlike structures made up of protein and a single molecule of DNA…
Q: (assuming they exist) where do they evolve? And explain pls.
A: Mermaids are imaginary creatures which have the upper part of the body as human and lower part of…
Q: a) Define the Following: i) Ecology ii) Environment iii) Ecosystem b) State and Explain the…
A: a) Define the Following: i) Ecology ii) Environment iii) Ecosystem b) State and Explain the…
Q: PART B Re-watch the video and explain why the following steps are necessary: Why use tweezers to put…
A: Please note as per the site regulations, external links are not watched. Hence, part A cannot be…
Q: What are the six functions of the plasma membrane?
A: A biological membranes which serves as a barrier between a cell's outside and inner surfaces is the…
Q: Granulocytes and monocyte Platelets Myeloid stem cell Lymphocytes and NK cell Hemocytoblast Lymphoid…
A: Hematopoiesis The process of formation of blood cells is described as hematopoiesis. It begins in…
Q: What would happen if all the birds in this activity got sent to an island where no birds had been…
A: Introduction Evolution and variations in beaks of birds, As the theory of Natural Selection,…
Q: Match the lipoprotein or reaction based on the lipid transport pathway shown: DIETARY FAT AND…
A: Biological macromolecule are the molecule that is needed in enough amount for the body . It mainly…
Q: Assuming that no new mutation was present in their daughter, offer a genetic explanation for her…
A: Haemophilia is an X linked recessive disorder. In such cases, males (XY) With one copy of defected…
Q: In Brinjal eggplants, purple fruit is incompletely dominant to white fruit, with the heterozygote…
A: When a white flowering plant is about to make a cross with a purple flowering plant, the resultant…
Q: Define and compare a bacteriophage lytic cycle and lysogenic cycle.
A: ANSWER) Lytic cycle of bacteriophage is the cycle in which the cellular mechanism on the host cell…
Q: Can someone explain the concept behind a sample that lies in the UV range in a spectrophotometer?…
A: UV spectroscopy or UV–visible spectrophotometry refers to absorption spectroscopy or reflectance…
Q: Using CRISPR/Cas9 to target a gene in the mouse will primarily result in: a. Any of the choices b.…
A: CRISPR/Cas9 is a powerful tool that can be used to target and edit genes. This technology has a wide…
Q: Write three to five sentence paragraph that reflects on your own understanding about mendel's law of…
A: Gregor Mendel, is also known as the father of genetics, he is remembered for his hybridisation…
Q: https://studylib.net/doc/8245959/lab-7--got-milk%3F follow and open the link then answer the…
A: Introduction Operon model gives the basic concept about the gene regulation in bacteria. It was…
Q: 14. Which of the following best explains the morphological species concept? a. Sexual reproduction…
A: The phylogenetic tree is a hypothesis because they reflect the best model, or explanation, of…
Q: What is the best way to describe millipedes? a. Flat and elongate, two pairs of appendages per…
A: Introduction: Any member of the arthropod class Diplopoda, which is found all over the world and is…
Q: 1- "Man is the only real enemy we have. Remove Man from the scene, and the root cause of hunger and…
A: Ecology is the science that deals with the distribution of a number of living species influenced by…
Q: Retrograde and anterograde transport occur in the dendrites cell body (soma) axon axon hillock
A: Axonal transport is a physiological process that transport proteins and other substances synthesize…
Q: 6.Explain how you should look into a microscope that has two oculars. 7. What two parts of the…
A: 6.Answer----
Q: Compare the 1D and 3D structure of 3HRW. What are the advantages of using 3D structure over 1D…
A: The linear sequence of amino acids within a protein is called the primary structure of the protein…
Q: Create a concept map linking hemoglobinopathies to the molecular foundations of these diseases and…
A: In this question we have to make a concept map of the disorder sickle cell anemia. See full answer…
Q: If a diploid organism has 14 chromosomes (2n=14) a. How many chromosomes will its gametes have?…
A: Introduction: Meiosis is type of cell division which results into the four daughter cells each…
Q: I || 1 1 2 2 O 3 1 2 4 3
A: As per our guidelines we are not allowed to answer 3 sub parts at a time please ask rest of the…
Q: > The heat on your finger in triggers a/an_____ your skin. The activate something like the muscle,…
A: The heat on your finger triggers a/an stimulus in your skin. The interneuron activate something like…
Q: Describe the type and strength of the relationship between number of chicks and predators. positive,…
A: Correlation coefficients are numerical measurement that determines the strength of a relationship…
Q: Given this DNA strand: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’ Identify the following: mRNA:…
A: The process by which DNA is copied to RNA is called transcription, and that by which RNA is used to…
Q: 2. Give the pathology in : 1 sentence each only a. hemolytic-uremic syndrome b. thrombocytopenia…
A: Hemolytic uremic syndrome: It is basically induced by bacteria which is resulted from the food such…
Q: For each of the ff. scenario, state whether the gene is up- or down-regulated and briefly explain…
A: Histones are proteins that package and protect DNA. They are subject to a variety of modifications,…
Q: B Based on all the charges around a neuronal membrane, the resting membrane potential is closer to…
A: Resting potential of membrane is much closer to K+ ion equilibrium potential.
Q: Which refers to the thickening and hardening of the arteries caused by plaque build-up?…
A: The hardening of the arteries occurs when fat, cholesterol, and other substances build up in the…
Q: 1 Annotate Figure 16.5, which is a schematic of the replication fork. a. In each box, write the name…
A: DNA replication The process by which DNA duplicate itself.
Q: An electrode was placed on a neuron and the voltage across the membrane was measured as the neuron…
A: Neurons are the structural and functional units of the nervous system. They perform the task of…
Q: Why aren’t drug companies producing new antibiotics
A: The important advancement in technology in the twentieth century was the invention of many…
Q: Pyruvic acid fermentation, which produces lactic acid, occurs A. aerobically B. anaerobically C.…
A: Introduction:- Pyruvic acid is used by some bacteria to create lactic acid. Animal muscle cells…
Q: Why was this row of evergreens planted on an Indiana farm?
A: Biofencing Is often referred to as Live Fencing. These are tree or shrub lines placed along farm or…
Q: Question:- Define the bacterial categories that each type of bacteria belongs to. You only have to…
A: Microbes, which are tiny and nearly invisible, have had a huge influence on society since the…
- Identify possible etiologic agents.
(a) Enumerate diagnostic tests for the said etiologic agent and choose the one you will order for your patients.
give answer asap please
Step by step
Solved in 2 steps
- What does the acronym TPA stand for and how is TPA used in diagnostic medicine? Explain briefly.a) Define EDso and TDso. Calculate the therapeutic index (TI) for each of the following drugs based on the dose-response curves provided. Comment on the safety of these two treatments. 100 80- 60- 40- 20- Drug 1 Therapeutic effect Toxic effect 100 200 300 400 500 600 700 Drug dose (mg) 100- Therapeutic effect 80- 60- 17 40- 20- 0- 10 20 Drug 2 40 Toxic effect 60 80 100 120 Drug dose (mg) 140Name the commonly used anticoagulants for hematological studies. Give theirmechanism of action, specific uses, advantages and disadvantages.
- What are the different component of therapeutic index. Define its clinical relevanceAs a pharmacist, propose some improvement that can be implemented to further improve the formulation stability. Answer the following case study using your own words.Customized medications are: Select one: O a. O b. O C. O d. Formulations that meet a patient's therapeutic needs F3 Formulations that can only be manufactured pursuant to a prescription Formulations that only contain non-medicinal ingredients Formulations that contain API's listed in the CPS mod/quiz/attempt.php?attempt=186101&cmid=102359&page=44# F4 F5 0 Q Search F6 1 L 160 के alel E
- Create a sample template of the patient medication profile (Note: Do not use the sample found on the internet. You must design your own template.)What is Metered Dose Inhalers(MDI)? Briefly Discuss the formulation and drug aerosolization process from a MDI? Please briefly discuss at your own words.A. Give the definition of the following (at least 2 sentences each) : 1. Immediate container2. Label3. Medication error4. Medication order5. OTC drugs B. Give five examples of dosage forms.
- DO NO INC de zeros at the end of decimal numbers. The problems and drug orders are presented for practice only, and actual prescribed factors. Order: Monocid 500 mg Supply: Monocid 1,000 mg Directions: Reconstitute with 2.5 mL of sterile water to yield 325 mg/mL Give: mL 4. Moving to another question will save this response. Type here to search EO 9Do not include zeros at the end of decimal numbers. The problems and drug orders are presented for practice only, and actual prescribed dosages will vary according to a patient's age, condition, reaction, additional medications, and other factors. Order: Supply: Directions: Give: Zithromax 500 mg 2 hours prior to dental procedure Zithromax 500 mg vial Reconstitute with 10 mL sterile water to yield 250 mg per 5 mL mL Moving to another question will save this response. Type here to search 15 O M 9 P DELLWhat are the: a.)Active Ingredient Classification (ex. Analgesic) B.) Brand Names available in the market(ex. Biogesic) C.) Label claim (ex. 500 mg/tablet, 160 mg/5 mL).d.) Dosage forms available in the market (ex. tablet) and matter classification (ex. solid/liquid/gas – homogeneous/ heterogeneous E.)Dosage and regimen (ex. take #1 500 mg tablet every 4 hours) f.)Pharmacologic Use or Indication. of a precipitated sulfur or the one at the third row only?
