Given the structures of the ribonucleotides and deoxyribonucleotides: Adenine Uracil Thymine HN Adenine NH HO-P-0- CH2 HO-P-0 CH2 HO-P-0-CH2 HO-P-0-CH он он он он OH H OH H Cytosine Cytosine Guanine Guanine NH2 NH NH2 CH2 HOo CH2 HO-P-0 -CH2 он он он он OH H OH H • Draw the structure of the polyribonucleotide UAGCCUG. Draw the structure of the polydeoxyribonucleotide CGTAGAT.

Q: Which of the following disaccharide repeats is the most stable towards hydrolysis?…

A: Hydrolytic stability is the resistance of a cured polymer material to reverting to a semisolid or…

Q: In an alpha helix, the carbonyl oxygen of residuen is hydrogen bonded to the amide proton of residue…

A: In alpha helix the carbonyl oxygen of residue there is one hydrogen bonds between the oxygen bonded…

Q: Which of the following is not a component of a deoxyribonucleotide? O phosphate O uracil O…

A: Deoxyribonucleotide is DNA, and uracil is not a component of DNA hence it is not not a component of…

Q: P04: all of the following are aromatic amino acids except-- a. Phenylalanine b. Tyrosine c.…

A: Amino acids are composed of amino group which is present on left side and acid group which is…

Q: Calculate and draw a line graph of the pI of the following: a. Histidine b. Arginine c. Aspartic…

A: pI: the pH at which an amino acid exits as a zwitter ion is called iso electric point. It is…

Q: Correctly match the complementary base pairs in RNA. ___Adenine ___Guanine 1.)Uracil 2.)Cytosine…

A: RNA consist of these four nucleobases : Adenine(A) Uracil(U) Guanine(G) Cytosine(C)

Q: A nonapeptide was treated with dithiothreitol to reduce any disulfide bridges, then partially…

A: Amino acids are the basic unit of the peptide and proteins. They are joined via the peptide bonds to…

Q: NUCLEOTIDES Label the parts of these paired naclootides..

A: Genes are the structural and functional units of heredity that carry coded genetic information in…

Q: NUCLEIC ACID "BASE PAIRING" 1. 5'-A-T-A-A-G-G-G-G-C-T-C-3' 2. 5'-G-G-G-G-C-T-A-C-T-C-3'

A: The nucleic acid base pairing follows simple rule A pairs with T while G pairs with C i.e purine…

Q: Indicate which base is (or bases are) the complementarypaired base(s) for each of the…

A: Answer: Introduction: DNA - Deoxyribonucleic acid is a molecule that is used for storage of genetic…

Q: Which amino acid from the following list best fits the alpha helix? lysine alanine glycine serine

A: When linear chain of amino acids folds to form recurring structural patterns, it forms secondary…

Q: To which synthetic family does each of the following amino acids belong? a. alanine b. phenylalanine…

A: Introduction: Depending on the chemical similarities of similar starting compounds, all of the amino…

Q: What is the function of this macromolecule? HH H H H H H H AA -c-c-c-c-c-c-H H-C-o H H HHHHH H HHHHH…

A: Biomolecules are the substances produced by living organisms to sustain their metabolism and other…

Q: he compound shown below is NH2 HC CH -O-P-0-CH н н H H OH H thymidine monophosphate. a nucleotide.…

A: DNA (deoxyribonucleic acid) was discovered by Friedrich Miescher. Nucleotides are the structural…

Q: Please correctly label the corresponding nitrogen bases in the image below. 3'end 5'end A adenine C…

A: DNA (deoxyribonucleic acid), is the molecule that contains the genetic code of organisms. It is a…

Q: The peptide segment shown below is part of a right-handed alpha helix. Please indicate the…

A: Alpha helixes are regular secondary structures. The hydrogen bonding pattern of an alpha helix is,…

Q: A polypeptide with a pH of 2.0 has a total net charge of 0. Gly-Pro-Glu-Asp-Leu-His-Ile-Gln-Asn-Phe…

A: This peptide is composed of glycine, proline, glutamic acid, aspartic acid, leucine, histidine,…

Q: Cofactor Nucleoside Homocysteine Sphingolipid 6. 7. 8. 9. НО НО ОН P-O но о 0=р НО. Но НО 10. НО. но…

A: A nucleotide is the basic building block of nucleic acids (RNA and DNA). Phospholipids constitute…

Q: The overall three-dimensional shape of a polypeptide is called O a. Alpha-Helix O b. Secondary…

A: After the formation of a protein, it is folded into a compact structure to do its function. Thus,…

Q: The genetic code is based on four different bases with the structures shown here. Determine the…

A: Nitrogenous base is a molecule that contains nitrogen and has the chemical properties of a base. The…

Q: H₂N H H₂C 0 a. Peptide bonds b. N terminal (name) C. C terminal (name) OH

A: Proteins are composed of amino acids. They are linked together by peptide linkages. Proteins have…

Q: Draw and label the following RNA tetranucleotide: 5’phosphoryl-A-2’O-methyl-C-U-G-3’-phosphate

A: DNA (deoxyribonucleic acid) and RNA (ribonucleic acid) are polynucleotides, i.e., they are polymers…

Q: NH OH OH Which nucleotide is shown in the picture

A: A nucleoside is a glycosylamine that is a nucleotide without a phosphate group. A nucleoside…

Q: Changing one amino acid within a protein sequence from a tryptophan to a stop codon would be best…

A: Mutation is the change in the nucleotide sequence of the DNA that causes a change in the mRNA.…

Q: Which of the following are known as helix breakers? O Proline Isoleucine leucine O Valine O…

A: Helix breakers are the amino acids that are capable of disrupting the alpha helical back bone and…

Q: Uracil (U Adenine HN 3 H- HO-P-0-P~0-P 0-CH, o-P H H. H H. 5 H OH OH он он 2 O-a-or O-a-or O-a-Or

A: Nucleic acid was first discovered by Fredrich Miescher from the nuclei of the pus cells (leukocytes)…

Q: Second Base A C G Phenylalanine Serine Phenylalanine Serine Tyrosine Tyrosine Cysteine Cysteine…

A: The fundamental physical and functional unit of heredity is the gene. DNA is the material that makes…

Q: Which of the following peptides will likely adopt an alpha helix structure? (idk)…

A: α-helix is a secondary structure of protein in which the polypeptide chain twists to form a helical…

Q: For the three peptides below, label whether they would form an amphiphilic beta-strand, amphiphilic…

A: Amphipathic beta-strand: The amphipathic beta-strands consist of a 1-3 amino acid pattern of…

Q: The number of hydrogen bonds between the two strands of a ds oligonucleotide given the following…

A:

Q: Fill in the blanks to identify each substance as(a) A nucleobase…

A: Heredity can be defined as the passage of the genetic information from one generation to another.…

Q: write the structure of the following nucleotides: 1. 5'-dGMP 2. 5'-dGDP 3. 5'-dGTP 4. 5'-GTP 5.…

A: The nucleotides are the phosphoric acid esters of nucleosides with the phosphate at the C-5'…

Q: Translate the following DNA sequence into amino acids 5'ATAGTACCGCAAATTTATCGCT3' O…

A: Answer :-                             Met-ala-phe-lys-stop                  DNA…

Q: Sort.. PURINES PYRIMIDINE Adenine Cytosine Dooxyribose Thymine Phosphate Group Guanine 2 Ring…

A: Nucleic acids are naturally occurring complex chemical compounds that serve as the primary…

Q: NH2 N- но-Р-О 'N' ОН ОН ОН

A: A is incorrect. Reason :  Adenosine does not have any phosphate group in it's structure.

Q: CH 0=P-O-ÇH2 'N' ОН Н a. What is the name of the nucleotide? b. Would this nucleotide be found in…

A: Step 1 This is a base of DNA; it can be seen by the ribose sugar structure visible in the bottom of…

Q: Amino Acid Sequence: LEU-ISO-PRO-PRO-PHE-ILE-LEU-LEU-SER-HIS-LEU-LEU-SER DNA Sequence:…

A: Closer the DNA constitution of organisms closer are they in their protein content. One can determine…

Q: Draw and label the following RNA tetranucleotide: 5'phosphoryl-A-2'O-methyl-C-U-G-3'- phosphate.

A: A tetranucleotide is sequence of four base pairs in RNA (ribose nucleic acid) is known as RNA…

Q: The structure shown below belongs to which family of protein tertiary structure? PDB: 1Z4A 1) a/ß…

A: PDB stands for the protein data bank and the 1Z4A is a ferritin protein from the Thermotoga Maritima…

Q: Use the first picture and codon table to answer the following questions.

A: The exons are the coding portions of the gene and introns are the non-coding portions, which need to…

Q: Draw the peptide formed between asparagine and histidine. H,N-CH-ċ-OH H,N- -CH—С—он CH2 ČH2 N° NH2…

A: Introduction: Proteins are one of the major macromolecules that helps in the structure and function…

Q: There are around 20 different versions of this molecule, which create different proteins when linked…

A: Protein is defined as a macronutrient that is important for building the body's muscle mass. It is…

Q: Consider the hydrogen bonding pattern of an α-helix with the following sequence: HLRTNAGCSY…

A: Proteins contain two types of secondary structures-alpha-helix and beta-strands. Alpha-helix is a…

Q: UCAQ UC AG UGA0 UC UCAG GUC UOPO AC Alanine Tyrosine Stop A GU Valine Y Cysteine G A Stop AG AC A G…

A: Genetic Code The genetic code is the relationship between the sequence of basis in DNA or its mRNA…

Q: THE CODON TABLE FIRST POSITION SECOND POSITION THIRD POSITION TT UU UCU UAU UGU Phenylalanine…

A: Mutations are alterations in the genetic sequence. These alterations can be small or big. The…

Q: Give the name of the base, the ribonucleoside or deoxyribonucleoside, and the ribonucleoside…

A: The RNA and DNA are the nucleic acids present in the cells . Both RNA and DNA consists of…

Q: Rank from left to right the compound with the most reactive chemical linkage: peptide bond, ester,…

A: There are different types of biomolecules found in nature. Various forms of biomolecules include…

Q: Create an oligopeptide via dehydration synthesis using the following amino acids. H. H. H -N…

A: The peptide is the bond, which is created between two or more amino acids. These bonds help to…

Q: Is the R group (CH3) on the amino acid alanine seen below, polar or non-polar? If there were several…

A: Amino acids are the structural units that make up a polypeptide or protein. All amino acids share…

Q: Explain why most nucleotides adopt the anti conformation.

A: In case of Uridine and Cytidine in DNA, in addition to bond rotations and sugar puckers around the…

Clinical Pharmacology

Pharmacology is a discipline of medicine that studies how medications interact with the systems and processes of living organisms, focusing on drug action mechanisms as well as therapeutic and other purposes.