write the structure of the following nucleotides: 1. 5'-dGMP 2. 5'-dGDP 3. 5'-dGTP 4. 5'-GTP 5. 5'pppGpC
Q: Which protein standard curve would you use to read off the protein concentration of an unknown…
A: Proteins are composed of twenty standard amino acids attached together via peptide bonds. Protein's…
Q: A newly synthesized protein contains a signal peptide on the N-terminus end of its polypeptide…
A: Proteins are a linear chain of amino acid sequences attached together via peptide bonds. There are…
Q: Whatarethewater-solublevitamins?Describeeachandtheirsources.
A: Introduction: Vitamins are organic compounds required in the diet in minimal amounts to perform a…
Q: NH NH но но NH HO но Deoxythymidine Zidovudine Stavudine
A: Nucleoside polymerase inhibitors are glycoside analogs that inhibit the action of the catalyst…
Q: he eukaryotic metallothionein gene promoter consists of all EXCEPT: MRE GC Box Pribnow box…
A: Metallothioneins are proteins that have high affinity towards binding heavy metal ions, and its…
Q: In a study, an undergraduate student discovered a new enzyme involved in the metabolism of…
A: Enzymes are usually protein molecules which catalyzes several biochemical reactions. It works as a…
Q: 3. The overall result of glycolysis can be summarized by the equation on the right in which the…
A: Glycolysis is oxidative metabolism of glucose molecule by formation of pyruvate which enters into…
Q: Explain the difference between serum and plasma. Additionally, why is serum the specimen of choice…
A: Serum and plasma come from the liquid portion of our blood which remains once the cells are removed…
Q: What is Diabetes Mellitus?How and why does it occur?
A: Diabetes takes place while the body frame isn't always capable of absorb sugar (glucose) into its…
Q: Which of the following is a product of the first stage of the pentose phosphate pathway?
A: Pentose phosphate pathway is a metabolic pathway that channelizes glucose in its glucose-6-phosphate…
Q: Problem 2. Competitive inhibitors are commonly used to make pharmaceuticals. Some cancer drugs act…
A: We need to plot the Lineweaver Burk Plot (LB Plot) to solve this problem. So first we need to find…
Q: Q2-A man (weight 65) ate a daily diet containing 65 g protein. So in a week, he weighed himself and…
A: Protein efficiency ratio - is the ratio of based on the weight gain of a unknown subject divided by…
Q: CREATE A COMPLETE MEAL PLAN FOR BLOOD TYPE A: INCLUDE BREAKFAST, LUNCH, SNACKS AND DINNER CONSIDER…
A: Blood type diet: Dr. Peter D'Adamo, a naturopathic physician, popularised the blood type diet,…
Q: In sickle cell anemia, an inherited form of anemia in which the hemoglobin distorts the red blood…
A: The mutation that alters the codon that codes for a specific amino acid is called missense mutation.…
Q: Compare and contrast Maillard reaction, caramelization and enzymatic browning in food.
A: A chemical reaction occurs when one or more chemicals (reactants) are converted into one or more…
Q: Which statement describes a competitive inhibitor? a. A competitive inhibitor has a structure…
A: Enzymes are biomolecules made up of amino acid. It acts as catalyst for biochemical reactions while…
Q: 10. Which of the following sequences would you expect to be a part of a beta turn? O PAAG O PAGA O…
A: Beta- turns are the simplest secondary structure, connecting two helices or sheets. They are…
Q: Based on the given picture, answer numbers 1-3. Also, answer number 4. 1. What are the two…
A: Hi! Thank you for the question. We are authorized to answer three subparts at a time, please repost…
Q: Compare and contrast some of the artificial sweeteners:aspartame,saccharin, sucralose, erythrol
A: Artificial sweeteners are used for sugar replacements. This sweetener provides a sweet taste to…
Q: You would like to identify the protein subunits in a macromolecular complex. What kinds of…
A: Proteins are the building blocks of aminoacids. The kind, amount, and sequence of amino acids that…
Q: .outline the processes used in the preparation of agarose gel of 1.5 concentration 5.outline the…
A: Electrophoresis is the migration of charged molecule in a medium under the influence of an electric…
Q: Using the data in this table, what is the AG° (in KJ/mol) for the reduction of FAD by water
A: The change in free energy is indicative of whether a reaction is spontaneous or not. If a reaction…
Q: Two of the bypass reactions of gluconeogenesis involve: a phosphorylation of ADP using phosphate…
A: Introduction: Gluconeogenesis is the synthesis of glucose or glycogen from a non-carbohydrate…
Q: Discuss models for how amyloid fibrils form from unfolded or misfolded proteins and for how the cell…
A: Misfolded proteins result in many degenerative diseases and this often occurs due to several…
Q: Why is PHC still relevant today?
A: 4. PHC Or Primary health care is a whole-of-society approach towards health and well-being that is…
Q: Tube Tube Tube Tube Tube Tube Tube Tube Tube Tube 4 7 8. 10 .1 .01 .001 .0001 x10 x10 x10 x108 x109…
A: Given Values: The dilution factor in each tube from the previous one is 1/10. It means the dilution…
Q: fat-soluble vitamins?
A: Fat soluble vitamins:-These vitamins are present in foods containing fats,the body absorbs these…
Q: Explain the difference between aldoses and ketoses including its configuration of D and L
A: Carbohydrates, proteins, and lipids are macronutrients that supply the body with energy and basic…
Q: As the strands are synthesized in replication, which of the following is true?
A: The process of in which DNA molecule produce exact copy or replica of itself is known as the…
Q: Biochemistry Question Quantitative Comparison Questions 2) A: Phospholipase C, as the Effector in an…
A: Effector molecules are small molecules which regulates the activity of other macromolecules. Thus,…
Q: describe strategies that are used to manage insect resistance in genetically modified (GM) crop
A: It is estimated that about 15% of world's crop yield is lost to insects or pests. The damage is…
Q: Complete the following chart about PDHK activity by determining if the molecule would be in high or…
A: Pyruvate dehydrogenase kinase stands for (PDHK). This PDHK belongs to the kinase enzyme family.PDHK…
Q: Five sweetener samples (labelled A to E) were tested by 97 individuals for the intensity of their…
A: Carbohydrates or carbs are maconutrient consisting of Carbon, hydrogen and oxygen atoms. In nature…
Q: Diets aimed at reducing coronary heart disease should be: low in trans-fatty acids and high in…
A: Coronary heart disease occurs when the blood supply of the heart is blocked due to build-up of fatty…
Q: The structure below is a OH HN. R Sphingomyelin Phosphocholine ceramide Sphingolipid All are correct
A: Sphingolipids are a class of lipids with sphingosine as their core molecule. Sphingomyelins (one of…
Q: Which of the following is not a general description of the gene expression regulation mechanisms…
A: Gene expression regulation mechanisms helps to maintain the rate of gene expression or to regulate…
Q: Sphingolipids do _________________. I. contain a glycerol core with a phosphocholine…
A: Glycerophospholipids and sphingolipids are complex lipids. They're present in biological membranes…
Q: CH2OH но но- ÓH CH2 но но. но он
A: Sugars are made up of carbon, hydrogen, and oxygen in the ratio of 1:2:1. Sugar molecules are also…
Q: Which of the following is NOT produced during the oxidative phase of the pentose phosphate shunt? a…
A: Pentose phosphate shunt is a metabolic pathway that is involved in the synthesis of pentose sugar…
Q: Briefly explain the process of enzyme reaction (in one sentence).
A: Introduction: Enzymes are biocatalysts that fasten the rate of the chemical reaction, by lowering…
Q: Which of the following is incorrect concerning protein structure determination by X-ray…
A: Protein structure determination by X-Ray Crystallography: is a technique used to obtain the 3D…
Q: is acetate present in TCA cycle? Are carbon atoms of acetyle-CoA are converted into CO2?
A: The citric acid cycle is an important metabolic process that links sugars, fat, and protein…
Q: opinion should be the definite characteristic
A: Life of any organism can be beneficial or harmful depends upon the nature of an organism.
Q: PKA is activated after its regulatory subunit is dissociated from the catalytic subunit. Select one:…
A: Hi! thankyou for the question. Since the questions belong to different concepts, we are authorized…
Q: explain the concept behind capillary electrophoresis in DNA quantification.
A: Introduction: Capillary electrophoresis is a technique that is utilized to separate complex mixtures…
Q: The peptide below contains how many amino acid residues?
A: The name 'amino acid' is derived from the amine and carboxylic acid groups, and so these two parts…
Q: What is phenylketonuria? Discuss its occurrence, symptoms if any, treatments if there are, and any…
A: Phenylketonuria, also known as PKU, is an autosomal recessive disorder. Since phenylketonuria is an…
Q: Complete the table by simply identifying only one example in each type of carbohydrate.
A: Monosaccharides - it is a basic unit of polysaccharides or carbohydrates, which cannot be broken…
Q: Enzymes that acetylate the ε-amino group of lysine in the histone tails are called ____ and are…
A: Histones are protein molecules present in nucleosome core of the chromatin material around the…
Q: 2. Dr. Kim at Research Center performed shotgun Sanger sequencing on an unknown DNA sample, and…
A: In conventional sequencing method, in a reaction mixture, single-stranded molecules of the DNA,…
write the structure of the following
1. 5'-dGMP
2. 5'-dGDP
3. 5'-dGTP
4. 5'-GTP
5. 5'pppGpC
Step by step
Solved in 2 steps with 2 images
- (a) Draw diagrams to show how the four synthetic oligonucleotides below could base-pair to form a stable model Holliday junction. W 5' GATCGCATTGTAGCCGTAGGTCCACTGTAA 3’ X 5' GTCCCATACGTAGCCGTAGGACATGTACCG 3' Y 5' CGGTACATGTCCTACGGCTACAATGCGATC 3' Z 5' TTACAGTGGACCTACGGCTACGTATGGGAC 3' I and 21Draw the structure of the following nucleotide: adenosine 3'-monophosphate or guanosine 2-monophosphateA segment of a polypeptide chain is Arg-Gly-Ser-Phe-Val-Asp-Arg. It is encoded by the following segment of DNA: G G C T A G C T G C T T C C T T G G G G A C C G A T C G A C G A A G G A A C C C C T Template strand with its polarity: 3’ C C G A T C G A C G A A G G A A C C C C T 5’ - Coding strand with its polarity: 3’ G G C T A G C T G C T T C C T T G G G G A 5’ Please write out the mRNA sequence generated by the template strand to produce that polypeptide chain.
- For each polypeptide derived in the following sequences: 5' CAA GAG GUA UCC UAC AGA 3' 5' GUC AUC UGG AGG GGC AUU 3' 5' CUA UGC AGU AGG ACA CCC 3' 1. Draw the structure of each polypeptide. 2. Label the amide bonds. 3. Identify the N-terminal and C-terminal amino acids. 4. Write the name of each polypeptide.Given the following eukaryotic DNA strand, transcribe and translate the DNA into a polypeptide using the 3’ – 5’ strand as the template. use drawings, diagrams, colours and annotations to describe how the DNA strand will be synthesized into a functional protein. 5’ - TATAAAAASSMSBMDATGSBDCCMBDBAATBSMDSTGTGTCCTMSBAG – 3’ (KEY: The letters SBMD are “made up” nucleic acids that depict non-coding regions in the DNA, hypothetically S pairs with B and M pairs with D).Outline the principle of how you would synthesise a library of approximately 1000 10-residue oligonucleotides with the sequence “5’-AGTNNNNNAT-3’” where N corresponds to any of the 4 nucleotides.
- Given the following eukaryotic DNA strand, transcribe and translate the DNA into a polypeptide using the 3’ – 5’ strand as the template. use drawings and diagrams to describe how the DNA strand will be synthesized into a functional protein.5’ - TATAAAAASSMSBMDATGSBDCCMBDBAATBSMDSTGTGTCCTMSBAG – 3’(KEY: The letters SBMD are “made up” nucleic acids that depict non-coding regions in the DNA, hypothetically S pairs with B and M pairs with D)Draw the following structure. 1)A single strand of DNA with the sequence 5' GCAT 3'Draw and label the following RNA tetranucleotide: 5’phosphoryl-A-2’O-methyl-C-U-G-3’-phosphate
- SYNZIPS are a-helices that can be used in synthetic biology to create coiled-coil interactions between two different proteins. SYNZIP1 is around 47 amino acids in length. If each turn in an a-helix is 3.6 residues in length and each turn is 5.4 Å in length, how long is SYNZIP1? Keep in mind that 1 Å = 10 nm. Present your answer in nm.3. The trp repressor is a homodimer with 107 amino acid residues per monomer. The content of proton dissociable groups of each monomer is given below: Side chain pKa number/monomer ZpH 4 ZpH 6 12.5 Arginine Aspartate Glutamate 9. 4.0 4.0 10 Histidine 6.0 2 Lysine Tyrosine -NH3® 10.0 6 9.5 2 7.0 1 -СООН 4.0 1 (a) ( : ) The isoelectric point (pl) of the protein, i.e., the pH at which the overall electrostatic charge on the protein E z = 0, is 5.3. Although the pKa values in the table above are only approximate values generally characteristic of residues with unhindered exposure to solvent, confirm that the overall charge on the protein must pass through zero between pH 4 and pH 6. ) Estimate what must be the average pKa value of all of the residues containing carboxylic (b) ( acid groups using the H-H equation below, assuming that the pka values of the positively charged groups do not change from the values given in the table above: pH pKa log [base]/[acid] + DNA teThe following is diagram of a generalized tetranucleotide. Carbons exist at corners on the shapes and phosphate groups are filled circles A. Suppose that one of the precursors for the tetranucleotide in the diagram was a 32P-labeled guanine nucleoside triphosphate (the innermost phosphate containing the radioactive phosphorus). Where is the radioactive phosphorus atom (i.e., one of the solid black balls) as it exists in the tetranucleotide B. If spleen diesterase (which induces breaks between the phosphate and the 5’ carbon) is used to digest the pictured tetranucleotide, state which base(s) among the breakdown products will be expected to be attached to the 32P.