Fill in the blanks to identify each substance as(a) A nucleobase                                  (d) A deoxyribonucleoside(b) A ribonucleoside                            (e) A deoxyribonucleotide(c) A ribonucleotide                            (f) A dinucleotide _____Adenosine                                    _____Uridine_____Cytidine 5′-monophosphate        _____ Deoxycytidine 5′-triphosphate_____Guanine                                        _____Deoxyuridine_____Thymine                                       _____Guanosine 5′-diphosphate_____Deoxyguanosine                          _____Thymidine triphosphate

Q: Tick ​​the correct statements:   Remember: Tautomers are structural isomers that differ from each…

A: Ans). The first statement, the third statement, and the fourth statement are correct. Explanation:…

Q: True or False, if the statement is false, provide the correct answer. 1. The amino acid sequence is…

A: Introduction Photosynthesis is the process by which plants transform CO2 absorbed from the…

Q: c.) ( between turns, glycosidic bond conformation and sugar conformation differs between A-form DNA…

A: DNA, is basically called deoxyribonucleic acid, is the hereditary material in humans and almost all…

Q: Correctly match the complementary base pairs in RNA. ___Adenine ___Guanine 1.)Uracil 2.)Cytosine…

A: RNA consist of these four nucleobases : Adenine(A) Uracil(U) Guanine(G) Cytosine(C)

Q: Which of the following statements about polynucleotide formation is correct? As a polymer, DNA is…

A: given are some statements regarding polynucleotide formation and the correct among them is given…

Q: A nonapeptide was treated with dithiothreitol to reduce any disulfide bridges, then partially…

A: Amino acids are the basic unit of the peptide and proteins. They are joined via the peptide bonds to…

Q: nscript: 3' TACAGTTAAGGCTCCACTGTTA 5' 5' 3' ino Acid Sequence (ex. Met-Trp- and so on) Second letter…

A: The genetic code is the relationship between the sequence of bases in DNA and the sequence of amino…

Q: The following strand of DNA is transcribed: 5'-GACCTCCGAATGC-3' Write the sequence of the…

A: Transcription:  It is the process of synthesis of mRNA from double-stranded DNA by the enzyme RNA…

Q: 5’ - A T G    G C C    C A A    C T G    A C C - 3’ a. How many nucleotides are listed here b. How…

A: Transcription is the process by which the genetic information encoded in DNA is copied into a…

Q: Determine the characteristics of this piece of double-stranded DNA.   GTCTTTTACTTGAAT…

A: DNA is the double helical structure that contains the information that help in inheritance. The…

Q: (a) Draw the structure of the high-energy nucleoside triphosphate GTP. (b) Draw the structure of the…

A: In the biological system, there are several metabolic reactions that occur that result in the…

Q: 5-Bromouridine is known to induce mutations in DNA. One of the characteristics of this compound is…

A: 5-Bromouridine is a uridine subordinate with a Bromo substituent at the fifth carbon. Br -Urd is…

Q: 5)(comprehension) In double-stranded DNA, which of the following base RATIOS ALWAYS EQUALS 1?…

A: Erwin Chargaff proposed two rules which are termed as Chargaff's rule. These rules played an…

Q: Which of the following statements about DNA and RNA is CORRECT? Select an answer and submit. For…

A: Nucleic acids are polymeric molecules with a long chain. The monomer or repeating unit is known as a…

Q: 1. What would be the amino acid sequence encoded by the MRNA 5'CCAUGACGUCGGAUCAAUGAGC 3' 2. If the…

A: DNA replication is the process in whichbbhvgvhghhccvfgcbgvh

Q: A) Draw the structure and give the name of a nucleotide made of G + ribose. B) Write the…

A: Ribonucleic acid (RNA) is a polymer of ribonucleotides that participate in diverse biological roles…

Q: The Bacteria Escherichia coli DNA genome has a molecular mass of about 3.1 X 10° D. In your answers,…

A: Given data: The molecular mass of the genome of Escherichia coli = 3.1 x 109 Da. The average…

Q: Draw the following structure. 1)A single strand of DNA with the sequence 5' GCAT 3'

A: Sure, here's a simple representation of a single strand of DNA with the sequence 5' GCAT 3':   5'  G…

Q: (a) (b) (c) The figure shown below is the mechanism of a DNA nuclease. The DNA molecule is in blue…

A: The given figure shows the mechanism of a DNA nuclease. Nucleases breaks the phosphodiester bonds of…

Q: 47. Is the following a polymer of DNA or RNA? Explain how you can determine this. (Give two pieces…

A: RNA is ribonucleic acid which is made up of ribo nucleotides. RNA is single stranded molecule with…

Q: Select the chemical consequences that could contribute to DNA instability at AP sites. fewer…

A: An apurinic/apyrimidinic site or abasic site can be created as a result of DNA damage or as a part…

Q: otal nucleic acids are extracted from a growing culture of yeast cells. They are then mixed with…

A: Although ssDNA could be a critical intermediary in practically all biological activities involving…

Q: For each term in the left column, select the term which best matches. 1. deoxyribonucleotide 2.…

A: DNA is the nucleic acids present in the organisms. DNA is the deoxy-ribose nucleic acid in which…

Q: ALL GROUPS HAVE A MUTATION MAKE SURE TO IDENTIFY THEM**

A: A mutation is a change in a DNA sequence. It can result from DNA copying errors made during cell…

Q: 6). What is the relationship (if any) between the following strand and the strands shown in sections…

A: DNA-Deoxyribonucleic acid  is a molecule that contains genetic information for the development for…

Q: The Bacteria Escherichia coli DNA genome has a molecular mass of about 3.1 X 109 In your answers,…

A: The bacterium Escherichia coli, commonly known as E. coli belongs to the family of gram negative…

Q: Below is an image of a basepair and associated ribose rings as viewed down the helical axis in B DI…

A: Introduction: Deoxyribonucleic acid or DNA is a type of molecule known as a nucleic acid that…

Q: explain why the order is 3–1-4-2 and not another way, thank you so much

A: Shotgun sequencing It is a method used in laboratories to identify the DNA sequence of a genome. The…

Q: Given the structures of the nitrogenous bases shown in the picture, draw the structure of a part of…

A: The nitrogenous bases shown in the figure are Adenine (A), Guanine (G), cytosine (C), uracil (U) and…

Q: nbonucleotide in automated RNA synthesis. Point to the functional groups

A: In automated RNA synthesis, a ribo nucleotide is used. When we look at epinephrine signalling, we…

Q: What determines the sequence of nucleotides in the template strand of DNA? (The answer can be very…

A: dna is the genetic material . it is formed via the polymerization of nucleotides . a dna molecule…

Q: draw the structure of the polynucleotide GT

A:

Q: H Н Н H

A: A tetranucleotide is a DNA fragment sequence having four bases. The answers to the question are…

Q: Look at the image of the the dinucleotide (two nucleotides joined togethr in a single strand). Base…

A: Nucleotide are the basic building blocks of DNA. A nucleotide consists of a sugar, nitrogenous base…

Q: choices: purine or pyrimidine ribose or deoxyribose 1-9? hydrogen or phosphodiester 1-9? an -OH…

A: Nucleotides are the building blocks of DNA and RNA, two essential nucleic acids in living organisms.…

Q: The DNA helix is stabilized by I. hydrogen bonds between primary amine groups and keto groups II.…

A: DNA is a double-stranded nucleic acid present within the nucleus of the cell. The double-helical…