Correctly match the complementary base pairs in RNA. ___Adenine ___Guanine 1.)Uracil 2.)Cytosine 3.)Thymine

Correctly match the complementary base pairs in RNA. _Adenine _Guanine 1.)Uracil 2.)Cytosine 3.)Thymine

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Related questions

Q: DNA in the form of a double helix must be associated with cations, usually Mg²+ . Why is this…

A: DNA is made up of two strands wind around one another to form double helix. The two strands are…

Q: In the complementary base-pairing rule, ________________. Question 9 options: a nucleotide can…

A: Erwin Chargaff, a scientist, observed that practically all DNA molecules have roughly equal amounts…

Q: How did they get GCC to GUC? and AAC to AAU?

A: The mutation is the change in the sequence of nucleotides in DNA. The sequence of nucleotides in DNA…

Q: Can a DNA strand bind to a complementary RNA strand? Explain.

A: DNA is the main constituent of the chromosome. It contains all information about protein that forms…

Q: Nonstandard Base _____ Often Occurs Between ____ and Anticodons.

A: Non-standard base pairing or Non-canonical base pairing refers to the hydrogen bonding between…

Q: All questions a) What is the DNA base sequence of Codon 1? b) What is the anticodon sequence for…

A: DNA ( deoxyribonucleic acid) is the genetic material that the organism inherits from the parental…

Q: Which strand was used to form the following amino acid. strand 3 "ATGGAATGTTTACCCGTATTATACGGATAGACG…

A: The four bases of DNA—the A, C, G, and Ts—are strung together in such a way that the cellular…

Q: Bidentate interactions are those where two or more hydrogen bonds are made with a base or base pair.…

A: Introduction A base pair is a fundamental building block of double-stranded nucleic acids made up…

Q: On which of the following amino acids is an N-linked glycan added to? A.Asparatic acids…

A: Basic amino groups (-NH2) and carboxyl groups (-COOH) are found in amino acids. Proteins have amino…

Q: The formation of deoxyribonucleotide from ribonucleotide requires all the following except:…

A: A nucleotide is the basic part of nucleic acid that contains nitrogenous bases (adenine, thymine,…

Q: A) Draw the structure and give the name of a nucleotide made of G + ribose. B) Write the…

A: Ribonucleic acid (RNA) is a polymer of ribonucleotides that participate in diverse biological roles…

Q: Select the best answer or answers from the choices given: The information sequence that determines…

A: Introduction DNA and RNA are the main genetic material found in all the species irrespective of…

Q: Translate this nucleotide sequence into an amino acid sequence. Gene Sequence (5'-to-3'):…

A: Translation is a biological process that converts a nucleotide sequence into an amino acid sequence.…

Q: DNA is composed of ___________, which are attached to each other by _______________ bonds. A) amino…

A: The biochemical material that is carried from the preceding generation to the succeeding generation…

Q: Which of the following is most likely to be an RNA nucleotide? a. Adenosine-5'-triphosphate b.…

A: A nucleic acid is a linear polymer of nucleotides that is a component of the cell's information…

Q: Which of the following nucleotides found in DNA is dGTP? Note, hydrogens bound to carbon atoms are…

A: A nucleotide consists of a sugar molecule (be it RNA ribose or DNA deoxyribose) bound to a phosphate…

Q: Which of the following does cytosine pair with?a. guanineb. thyminec. adenined. a pyrimidine

A: A gene is the fundamental physical and useful unit of heredity. Genes are comprised of DNA. A few…

Q: Identify the base labeled B. cytosine thymine O adenine O guanine A C B D

A: Nucleotides are the building blocks of DNA and RNA. Nucleotide is composed of a sugar, phosphate and…

Q: Two highly negatively charged complementary strands of DNA come together to form a double helix.…

A: Deoxyribonucleic acid (DNA) is the nucleic acid which contains the hereditary information that is…

Q: Select the best answer or answers from the choices given: The RNA species that travels from the…

A: Proteins are unbranched polymers constructed from 22 standard alpha amino acids. The fundamental…

Q: The genetic code is redundant (i.e., most amino acids are coded for by more than one codon). Why is…

A: Redundancy refers to differences in the third base of the codons coding for the same amino acid.

Q: why can cells not convert from protein into RNA?

A: Introduction :- Ribonucleic acid (RNA) is a DNA-like molecule. RNA, unlike DNA, is a single-stranded…

Q: Which strand was used for the following old amino acid. strand 3 "ATGGAATGTTTACCCGTATTATACGGATAGACG…

A: By the process of transcription mRNA is produced from the DNA. the transcription process occurs…

Q: Describe the effect on the protein if the base pair #6 in the parent DNA chain is misted from G/C to…

A: Deoxyribonucleic acid (DNA) is the foremost key genetic constituent of all life forms. It is further…

Q: TRUE OR FALSE: a) Each tRNA has unique identity elements recognized by its specific enzyme involved…

A: The translation is the process where individual amino acids are joined by forming a peptide bond. It…

Q: What is the protein product of the following DNA sequence? 5'-AACTCCGACTACGCTCCATTTCGAGCA-3'…

A: Proteins are complex biomolecules made up of chains of amino acids that fold into specific…

Q: The phosphate group furthest from the sugar in a nucleotide is the, phosphate Select an answer and…

A: Deoxyribonucleic acid (DNA) and Ribonucleic acid (RNA) consist of long chains of nucleotides. A…

Q: Define the following terms: a. oligonucleotide b. nuclease c. phosphodiesterase d. nucleosidase e.…

A: The genetic material, DNA that transfers the genetic information from one generation to another by…

Q: a) The genetic code in unambigous that means many codons can code for the same amino acids. b)…

A: 1. The genetic code is UNAMBIGUOUS:- Means that each triplet specifies only a single amino acid.…

Q: Look at the codon "UUU" in the codon chart. If the 3rd nucleotide (3rd Uracil) was mutated to a "C"…

A: The genetic code is triplet code called codon.The genetic code is degenerate meaning that given…

Q: Which of the following amino acids is unique in that it can bind both non-specifically to the DNA…

A: All the protein that interact or bind with the DNA is called as the DNA binding proteins. These DNA…

Q: 1. TRUE OR FALSE a) Eukaryotic mRNA contains the message from the DNA for the synthesis of one…

A: In polycistronic mRNA the mRNA can encode several proteins and is characteristic of many bacterial…

Q: RNA molecules are more reactive than DNA molecules. Explain.

A: DNA is a deoxyribonucleotide which was a double-stranded molecule that has a long chain nucleotide…

Q: Choose any pentapeptide composed of five different amino acids. List the amino acids. Present one…

A: INTRODUCTION In cells, messenger RNA is a molecule that transports information from the nucleus to…

Q: The following define nucleic acids EXCEPT А They are polyionic molecules of high molecular weight…

A: Nucleic acids are Deoxyribonucleic acid (DNA) and ribonucleic acid (RNA).

Question

Correctly match the complementary base pairs in RNA.

___Adenine
___Guanine

1.)Uracil
2.)Cytosine
3.)Thymine

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Similar questions

Define the following terms: a. β-hairpin b. supersecondary structure c. fibrous protein d. globular protein e. mosaic protein
What type of nucleic acid corresponds to the statement? -Both -DNA only -RNA only -Neither 1.) cytosine is equal to guanine 2.) bigger molecular size 3.) can tolerate alkali hydrolysis
What type of nucleic acid corresponds to the statement? -Both -DNA only -RNA only -Neither 1.) susceptible to denaturation 2.) measured based on density of units 3.) part of central dogma
Proteins don't have the same extent of repair mechanisms that nucleic acids do. Therefore, when they get damaged, they often need to be broken down. Describe how this process occurs - how are "bad" proteins identified, what happens to them, and how are they degraded?
What property of RNA would make it capable of acting as a ribozyme? Why don't we have any naturally occuring DNA enzymes?
I have two proteins with 20 % sequence identity. I ask you if this is likely to be significant. What other simple piece of information do you need to answer this question properly ?
DNA is made of codons, which are sequences of three of the following molecules: Guanine (G), Adenosine (A), Cytosine (C), and Thymine (T). Repetitions are normal. How many different codons are possible that start with Guanine?
O N Z—I H What is the name of the nitrogen base component of RNA shown here? ΝΗ Question 19 of 25 FO A) uracil B) guanine C) adenine D) thymine E) cytosine Submit +
Thymine diners A) causes a covalent bond or occur between the complimentary nucleotides B) are an example of the environment causing mutations to our genes C) can never be repaired D) are only found between adjacent adenines
A virus has a double-stranded RNA genome that has 2400 base-pairs. Of these, 35 % are G:C base-pairs. How many uracil nucleotides would be present in this virus?
why can cells not convert from protein into RNA?
3)Which of the following statements are true? Choose all that apply a)There are multiple codons possible for nearly all amino acids b)Each stop codon also codes for an amino acid c)Each tRNA will base pair with only one codon d)The start codon also codes for an amino acid e)Each codon in mRNA codes for exactly one amino acid f)Each codon in tRNA codes for exactly one amino acid g)Each anticodon in tRNA pairs with exactly one codon h)Each tRNA carries exactly one type of amino acid