Correctly match the complementary base pairs in RNA. ___Adenine ___Guanine 1.)Uracil 2.)Cytosine 3.)Thymine

Correctly match the complementary base pairs in RNA. _Adenine _Guanine 1.)Uracil 2.)Cytosine 3.)Thymine

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Related questions

Q: Many of the loops on proteins are composed of hydrophilic amino acids. Why might this be the case?

A: Protein is one of the important biomolecules. This protein is made up of sequence amino acids which…

Q: The 5' end of an mRNA corresponds to the __________ end of a protein. Question 27 options: A) 5'…

A: Biological molecules are those large molecules that are found in the cells of an organism which are…

Q: Which of the following types of enzymes is primarily responsible for setting up the genetic code?…

A: Enzymes are the biocatalyst ,which increases the rate of chemical reactions in the body.Most of the…

Q: Which of the following exhibit(s) the "quaternary" structure of nucleic acids? a.ribosome…

A: Quaternary structure of nucleic acids refers to the higher-level organization of nucleic acids,…

Q: Draw the structures of adenine and uracil (which replaces thymine in RNA), and show the hydrogen…

A: A nucleotide is defined as an organic molecule composed of a nucleoside and a phosphate group.…

Q: Match the function in translation to each type of RNA (one RNA has two listed functions). 1) Carry…

A: The process where RNA transformed into protein called translation. There are all three types of…

Q: TRUE OR FALSE a) The electron rich nature and aromaticity of the nucleobases mediates their…

A: Nucleobases are also known as nitrogeneous bases which are nitrogen-containing biological compounds…

Q: They are related in str They have identical ba C) they are the result of a

A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…

Q: 3) During charging of tRNAS Select an answer and submit. For keyboard navigation, use the up/down…

A: The translation is a process by which proteins are synthesized. It is the last step of the central…

Q: Which strand was used to form the following amino acid. strand 3 "ATGGAATGTTTACCCGTATTATACGGATAGACG…

A: The four bases of DNA—the A, C, G, and Ts—are strung together in such a way that the cellular…

Q: What do you mean by myristylated N-terminus?

A: N-myristoylation is the process in which myristic acid is attached to N-terminal glycine. It occurs…

Q: In RNA, an atypical base pair is able to form between guanine and uracil. This base pair allows a…

A: Introduction A Base Pair Is Made Up Of Two Chemical Bases That Are Bound Together To Form A "rung Of…

Q: All of these materials are needed for translation EXCEPT: O A) TRNA O B) ribosomes C) RNA polymerase…

A: Translation, in molecular genetics, is the mechanism by which ribosomes in the cytosol or…

Q: β-mercaptoethanol ____, and urea _____ disrupt the interactions involved in formation of α-helices.…

A: DNA stands for deoxyribonucleic acid. It is the genetic material of the organisms that transfer from…

Q: the sequences od tRNA and corresponding mRNA is complementary to each other. is the statement true…

A: The synthesis of a functional protein involves two processes namely transcription and translation.…

Q: RNA differs from DNA in that: a) The ribose in RNA nucleotides contains fewer oxygen atoms than does…

A: DNA = Deoxyribonucleic acid is a polymer. Which is composed of two polynucleotide chain. That chain…

Q: The formation of deoxyribonucleotide from ribonucleotide requires all the following except:…

A: A nucleotide is the basic part of nucleic acid that contains nitrogenous bases (adenine, thymine,…

Q: Select the best answer or answers from the choices given: The information sequence that determines…

A: Introduction DNA and RNA are the main genetic material found in all the species irrespective of…

Q: Nucleic acids involved in protein synthesis include DNA sense strand DNA anti-sense strand mRNA…

A: Nucleic acids are composed of phosphoric acids, sugars, and mixtures of organic bases like purines…

Q: A small section of a gene for a protein has the following nucleotide sequence: TAT AGG GAC CTA TGT…

A: A small section of a gene for a protein has the following nucleotide sequence that codes for the…

Q: Which of the following is most likely to be an RNA nucleotide? a. Adenosine-5'-triphosphate b.…

A: A nucleic acid is a linear polymer of nucleotides that is a component of the cell's information…

Q: Which of the following could be the DNA template for the following protein primary structum…

A: The DNA is transcribed to produce the mRNA which gets translated into protein. Proteins are polymers…

Q: Which of the following does cytosine pair with?a. guanineb. thyminec. adenined. a pyrimidine

A: A gene is the fundamental physical and useful unit of heredity. Genes are comprised of DNA. A few…

Q: Which of the following sequences is most likely to form an unstructured loop in a protein structure?…

A: Proteins are polymers of amino acid sequences. Therefore they are known as polypeptides. There are…

Q: Select the best answer or answers from the choices given: The RNA species that travels from the…

A: Proteins are unbranched polymers constructed from 22 standard alpha amino acids. The fundamental…

Q: Transcribe the following DNA sequence into codons.…

A: Transcription is a process in which there is formation of messenger RNA from the DNA template In…

Q: What do you mean by mRNA and tRNA?

A: Step 1 RNA or ribonucleic acid is a single-stranded mixed polymer of four types of ribonucleotides,…

Q: Why is DNA and not any other macromolecule represents the genetic code?

A: Biomolecules are organic compounds found in living organisms. All living organism will have these…

Q: Which of these represents the correct order of events going from DNA to Protein? a) Transcription,…

A: False B is not an okazaki fragment C represents the okazaki fragments. Okazaki fragments are…

Q: Which of the following is a reason why codons are NOT composed of only two nucleotides? Question 22…

A: The biochemical substance that is carried forward from the preceding generation to the succeeding…

Q: 5' 5' X Y 5' Codon Codon Codon Codon Codon Codon 1 2 3 4 5 6.

A: The DNA (deoxyribonucleic acid) is the hereditary unit of an organism. It consists of purines and…

Q: TRUE OR FALSE: a) Each tRNA has unique identity elements recognized by its specific enzyme involved…

A: The translation is the process where individual amino acids are joined by forming a peptide bond. It…

Q: In one (1) sentence point out a key functional similarity and difference in each of the pair of…

A: Amino acids are the building blocks of proteins that are classified as acidic, basic, and Amino…

Q: What is the protein product of the following DNA sequence? 5'-AACTCCGACTACGCTCCATTTCGAGCA-3'…

A: Proteins are complex biomolecules made up of chains of amino acids that fold into specific…

Q: Most amino acids are coded for, by more than one codon. Consequently the genetic code is…

A: Introduction: The genetic code is a set of laws that define how DNA's four-letter code is translated…

Q: Cystic fibrosis (CF) is an inherited disorder caused by different types of mutations, many of which…

A: CF is caused by a mutation in a gene called the cystic fibrosis transmembrane conductance regulator…

Q: In an attempt to understand whether viruses rely on proteins or nucleic acids to transmit their…

A: The present knowledge of DNA's function in heredity has resulted in a wide range of practical uses,…

Q: If a protein is made up of 1000 amino acids 1) How many nucleotides will its mRNA contain…

A: Amino acids are the building blocks of proteins, which are responsible for the expression of genes.…

Q: Label the features of a tRNA by dragging the labels to the correct targets. A Binds an amino acid B.…

A: tRNA is also known as transfer RNA which helps in the transfer of amino acid to the mRNA codon…

Q: 1. TRUE OR FALSE a) Eukaryotic mRNA contains the message from the DNA for the synthesis of one…

A: In polycistronic mRNA the mRNA can encode several proteins and is characteristic of many bacterial…

Q: In the laboratory a team of peptide/protein chemists synthesize the HIV-1 protease from all…

A: According to the mirror symmetry, the corresponding D-peptide, as the enantiomer of that specific…

Q: 9) Which statement is inaccurate (wrong) about mRNA? A) it is double stranded and has thymine B) it…

A: The explanation for the wrong statement is given below.

Question

Correctly match the complementary base pairs in RNA.

___Adenine
___Guanine

1.)Uracil
2.)Cytosine
3.)Thymine

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Similar questions

You are treating a patient suffering with wound botulism in which Clostridium botulinum grows in a wound and makes a protein exotoxin, botulinum toxin. In addition to surgery to clean the wound and providing botulinum antitoxin, you wish to give the patient antibiotics to stop the protein toxin synthesis immediately. Which of the following antibiotics would you NOT give your patient if you wished to immediately stop bacterial translation? (best answer) O macrolides, e.g. erythromycin O trimethoprim plus sulfa drugs e.g. sulfamethoxazole O chloroamphenicol tetracylines aminoglycosides e.g. gentamicin
Look at Table 26.3 and find codons for the following amino acids:(a) Val (b) Arg (c) Ser
Proflavine was used to treat wounded soldiers in the Far East during the second world war. Which of the following statements is false regarding proflavine! H₂N7 NH₂ Its target is located in the cell membrane. Its planar shape is important to intercalation. The primary amine groups are protonated and interact with phosphate groups of the DNA backbone. When inserted into DNA, the tricyclic system can form van der Waals interactions with base pairs above and below it.
You are studying COVID-19 which infects bat cells through an interaction between a lysine residue on a viral protein with an aspartic acid residue on the bat cell protein. You discover that when the virus made the jump into human cells, the virus mutated the lysine residue to leucine. Based on your knowledge of amino acid chemistry, which amino acid(s) will the leucine most likely interact with? Briefly explain your answer.
Which of the following amino acid is acetylated when DNA is unwound from histones? a. Asparagine b. Lysine c. Arginine d. Glycine
1. ) In one (1) sentence point out a key structural similarity and difference in each of the following pair of terms: a) Proline and cysteine b) Secondary and Tertiary proteins c) Uracil and thymine d) AMP and dAMP e) codon and anticodon
Which level of protein structure would be most affected by the following changes... a) mutation from isoleucine to valine b) oxidation of two cysteine sidechains c) PrP (healthy prion protein, mostly a-helical) changes to PrP (infectious form, mostly ß-strand) (more than one answer!) d) increase in pH from 7 to 10
O N Z—I H What is the name of the nitrogen base component of RNA shown here? ΝΗ Question 19 of 25 FO A) uracil B) guanine C) adenine D) thymine E) cytosine Submit +
Thymine diners A) causes a covalent bond or occur between the complimentary nucleotides B) are an example of the environment causing mutations to our genes C) can never be repaired D) are only found between adjacent adenines
Draw the peptide formed between asparagine and histidine. H,N- -CH-C-OH H,N-CH-ċ-OH ČH2 ČH, N° NH2 -NH +
When the ribosome "reads" the codon UAG, UGA or UAA... A) the polypeptide is released from ribosome but ribosome continues reading the mRNA B) the proper tRNA enters the ribosome C) translation begins D) polypeptide is released from the ribosome and translation ends
List the three (3) types of RNA molecules and in one sentence each describe their functions.