Gene duplication A A Evolution AI A2 Speciation AI A2 AI A2 Evolution AI A2 AI A2 Evolution A A2 BI B2 Conclusion: Genes A1 and A2 are paralogs. Genes B1 and B2 are paralogs. Genes A1 and B1 are orthologs. Genes A2 and B2 are orthologs. 20.9 Homologous genes are evolutionarily related.

Why are some genes expressed and some not? Please be as detailed as possible.

A hypothetical base sequence of an RNA molecule is5′–AUUUGCCCUAGCAAACGUAGCAAACG–3′What topic in genetics does this question address?

Can you help me with this question?

https://ny.pbslearningmedia.org/resource/biot09.sci.life.gen.epigenetics/epigenetics/   Explain DNA methylation. How does this process influence cellular function?

In a mutant mouse, it was discovered that a gene "W" is moved from its original chromosomal locus to the telomere region, where chromatin is packed into heterochromatin. Given what we have learned about eukaryotic gene regulation, can you speculate how the expression of gene W in the new mouse line would be changed as compare to the normal mouse?   Question 18 options:   elevated in the mutant mouse than in the wild-type mouse.   cannot be determined.   reduced in the mutant mouse than in the wild-type mouse.   no change in the mutant mouse as compared to the wild-type mouse.