Q: Who is responsible for determining the safety andf efficacy of any dietary supplement? A. FDA B.…
A: Introduction Dietary supplements are substances that you can take to enhance your diet or reduce…
Q: How can you use the scientific method to study ranaviruses
A: Ranaviruses are a kind of pathogens which infects ectothermic vertebrate species .
Q: Which molecule(s) is directly activated by Ras-GTP? A. Gene regulatory proteins B. ERK (MAP kinase)…
A: Ras protein belongs to a class of small GTPase protein, which mainly functions in transmitting…
Q: differentiate between totipotent and multipotent
A: Introduction Stem cells:- These are the body's raw materials and are able to develop into many…
Q: State four reasons why barley is terminated in beer brewing process.
A: Beer brewing: The process of production of beer by steeping a starch source in water,…
Q: Concerns with the resident microflora of the Gl tract and certain toxicants include A Microflora are…
A: 18. The most essential enzymes engaged in the phase I metabolism of medicines and toxins in…
Q: Biology Question
A: Introduction Taxonomy is the branch of science that deals with the classification of organisms in…
Q: Why might the GluR-B mutation prevent calcium from moving through the receptor?
A: The physical and functional unit of that generally states that term which define the heredity is the…
Q: AUGGUGCCACCGCUGAAGAAGCCUGGACCCUGGCACCCUGUGGACCCUGCAUCCUGGACCCUGGGUGCCACCGCUGAAGAAGCCUGGACCUAGGGUGCCA…
A: The process of protein synthesis involves two major steps - Transcription Translation During…
Q: Thirst is a relatively poor indicator of dehydration for athletes? A. True B. False
A: Ans - B) False Physiologically thirst is a regulatory mechanism of the living organisms that…
Q: Which of the following nutrients is critical for a toddler's nervous systems development? A. Sugar…
A: The formation of your baby's brain is a complicated process that occurs throughout your pregnancy.…
Q: The USDA "Organic" seal on a product indicates that the food contains at least 95% organic…
A: The full form of USDA is 'United State Department of Agriculture. Rules regarding the use of the…
Q: Q7. In a community with 200 species, under which conditions would Simpson's diversity index have the…
A: A. 10 species have very large populations, and 190 species are present but with very small…
Q: i. Name the function for the white band of tissue at arrow A. ii. Name the space at arrow B. iii.…
A:
Q: Fadi was diagnosed of having chronic stress due the bad economic and political situations in…
A: The common cold is caused by viral infection. People under severe stress are more likely to catch a…
Q: Which of the following statements does NOT agree with the tenets of Darwin's theory of evolution by…
A: Darwin's influential and contentious book On the Origin of Species was published in the 1850s. He…
Q: Explain the evolutionary significance of mutations.
A: Abrupt changes in the DNA nucleotide or DNA sequence is called mutation. Mutation could be harmful…
Q: Given these options, which best describes the Cre-Lox system A) can be applied to control the…
A: The Cre-lox system is one of the most powerful and versatile tools developed for mouse genetics. It…
Q: Vaccination is the form of specific immunity usually results in generation of memory of a particular…
A: Introduction :- Vaccination is the process of administering a vaccine to aid the immune system in…
Q: Mule Deer Use the passage to answer the question. This image shows a male mule deer (Odocoileus…
A: Zone reserved : They are the area for conservation that is , it is untroubled area which is…
Q: furbaby scratches your friend. Her skin is reddened and feels warm and sore to the touch;
A: Connective tissue: The collection of cells combines to form a tissue. Tissue combines to form organs…
Q: What are the processes of the photochemical stage of the photosynthesis process?
A: Introduction :- Plants take in carbon dioxide (CO2) and water (H2O) from the air and soil during…
Q: Why are next generation sequencing reads determined after negative selection, while induction values…
A: Introduction :- The process of determining the primary structure of an unbranched biopolymer through…
Q: Describe the 5 basic steps of electrical and chemical neural signaling. A strong action will…
A: An axon's terminal button Microtubules serve as support inside the axon. "Balloons" packed with…
Q: Serum sickness does begin immediately upon the production of anti-BSA antibodies. How does the…
A:
Q: If the food is contaminated by bacteria, as long as fully boiled for over 10 minutes, it is still…
A: Introduction Bacteria are single-celled organisms that are tiny. Bacteria can be found practically…
Q: ms/d/e/1FAlpatseg The secretes a hormone that increases the body's metabolic rate, promotes…
A: Nodes of ranvier are specialised regions in axon. They are not insulated by myelin.
Q: Discuss about Platyhelminthes. Identify their classes and give the examples of it. Discuss about the…
A: INTRODUCTION R.H Whittaker grouped all organisms into five kingdoms He grouped all creatures based…
Q: What does CSL Bioplasma do to prevent viral transmission of plasma coagulation concentrates?
A: Answer :: For plasma-derived clotting factor concentrates used in the treatment of bleeding…
Q: Which one of the following terms best describes the structure of the cell membrane: A. fluid mosaic…
A: Plasma membrane forms the external boundary of cells and acts as a selectively permeable barrier and…
Q: The cells that are found in tendons are called: A. osteocytes B. adipocytes C. haemocytoblasts D.…
A: D. fibroblast is correct answer.
Q: Answer the question in three paragraphs. (Introduction, Body and Conclusion) 1. What is the…
A: Infection is the invasion and growth of germs in the body. The germs may be bacteria, viruses,…
Q: Narrow spectrum Penicillin act on
A: Penicillins is a group of antibiotics which is mainly obtained from penicillium moulds like…
Q: New genetic variations may occur because of (Check all that apply) Select 3 correct answer(s)" A)…
A:
Q: The body's innate defenses include all of the following EXCEPT? A. The skin B. Inflammation C.…
A: Innate defence is a system which is already present in our body from birth .
Q: Amplified target regions of four different samples were separated using gel electrophoresis. DNA…
A: Gel electrophoresis is a lab technique for separating DNA, RNA, and protein mixture based on their…
Q: U A) Small population increases the likelihood of losing alleles B) Population size reduced to a few…
A: When a small number of individuals is separated from a larger population, the founder effect occurs,…
Q: When at rest, our muslces only use a small amount of fat to provide energy, no use of glucose at…
A: Glucose It is a six carbon compound use by most of the living organism as fuel.
Q: /hich factor can affect the distribution of a toxicant in the body? A Blood flow to the tissue B…
A: 23.Heavy metals can build up in the liver, brain, kidneys, and heart once they've entered the body.…
Q: The cone system and the rod system: differ in response saturation at high levels of illumination O…
A: Answer :- Option (C) is correct. - are equally specialized for sensitivity of photon capture.
Q: FRET is a technique that measures the transference of energy between a donor and an acceptor…
A: A widely used fluorescence technique to study bimolecular interactions within cells is FRET, which…
Q: 2. Give examples on how work and energy are essential in biological systems.
A: Work is defined as a task that involves the mental and physical efforts to get it done. Energy is…
Q: ACTION ON THE HUMAN ORGANISM OF UV RADIATION WITH A WAVE LENGTH 320-280 nm 1. anti-rachitic 2.…
A: UV ultraviolet rays that are harmful rays emerging from sun and these are responsible for causing…
Q: 14.The human axial skeleton includes (This is a multiple choice question choose the answer from the…
A: The bones of human skeleton are divided into two groups the appendicular skeleton and the axial…
Q: Describe how DNA molecules are replicated.
A: Introduction :- Replication is the process of making two identical DNA molecules from a…
Q: Assess the following situations: a. A field planted with rice in their early vegetative stage…
A: Reproductive phase is the phase of the plant where the grains or seeds are produced after…
Q: ture MRNA. What are these modifications and what are their significance? Use = following terms to…
A: When introns are eliminated and the mRNA is regarded suitable for translation, eukaryotic pre-mRNA…
Q: You first need to create a plasmid. What are the minimal components necessary to develop this…
A: Since you have asked many questions, I'm giving you the answer of first 3 Please repost in order to…
Q: Fill in the blank with the term that best completes the sentence. 21. Switching between a haploid…
A: 21) Alternation of generations This helps the plants to adapt better to the environmental…
Q: Workplace Hazards 1. What are the types of environmental monitoring?
A: Environmental monitoring relates to the instruments and procedures used to monitor, characterise,…
Explain , What role does phosphorylation of tyrosine residues play in the action of receptor proteins?
Step by step
Solved in 2 steps
- What role does phosphorylation of tyrosine residues play in the action of receptor proteins?What role does phosphorylation of tyrosine residues play in the action of receptor proteins? And why is the significance of learning this question as a biochemistry student?Ligand binding to proteins may occur with varying strengths; some ligands bind tightly to proteins while others bind less tightly. The strengths of reversible binding are determined experimentally by varying concentrations of ligands, and measuring the saturation of the protein in the various ligand concentrations. One such laboratory study investigated the binding of a hormone to three different receptor proteins in the cell membrane. The data collected are shown in the table below: 1) Provide a brief explanation as to why ligand binding to proteins must be a reversible process. 2) Calculate the dissociation constant (Kd) for the hormone binding to each of the three proteins.
- Estimate the binding affi nity of a ligand for its receptor from the followingdata:Ligand binding to proteins may occur with varying strengths; some ligands bind tightly to proteins while others bind less tightly. The strengths of reversible binding are determined experimentally by varying concentrations of ligands, and measuring the saturation of the protein in the various ligand concentrations. One such laboratory study investigated the binding of a hormone to three different receptor proteins in the cell membrane. The data collected are shown in the table below 1) Which of the proteins demonstrate the tightest/strongest binding of the hormone? Which demonstrates the least tight binding of the hormone? What is the basis for your answer?What are g-coupled protein receptors? Explain the role they play in cell physiology.
- What are the three steps by which receptor tyrosine kinases typically convey an extracellular signal to another intracellular enzyme?Explain how a tyrosine kinase (YK) receptor becomes phosphorylated and activated upon ligand binding.What are G-protein-coupled receptors? Explain their function in regard to how particular regulatorymolecules influence different effector proteins in the membrane.
- Upon activation by a receptor, a G protein exchanges bound GDP for GTP, rather than phosphorylating GDP that is already bound. Similarly, the a subunit-GTP complex has a slow GTPase activity that hydrolyzes bound GTP, rather than exchanging it for GDP. Describe experimental evidence that would be consistent with these conclusions.Describe the general function and structural features of G-protein-coupled receptors (GPCRs). Be sure to include an explanation of GTPase activating proteins (GAPs) and GDP exchange factors (GEFs) in the context of the GTPase cycle. How are different classes of heterotrimeric G-proteins defined?Continuous exposure of a G protein-coupled receptor to its ligand leads to a phenomenon known as desensitization. Describe several molecule mechanisms for receptor desensitization