Why is there some signal present within the ‘no sugar’ and other noninducing sugars for the green fluorescence protein when under the control of an arabinose promoter? Please answer asap and type your answer and do not copy from anywhere please
Q: Write any two places where methanogens can be found.
A: Methanogens are classified under sub-kingdom Archaebacteria and kingdom Monera under five kingdom…
Q: Match the subfamilies of HSPGS withe their examples v syndecans and CD44V3 A. Secreted ECM…
A: Match the following. a. Perlecan and collagen XVII ---------------------------------------…
Q: What is the uncontrolled mitotic process that occurs as disease in pluricellular beings called?
A: Disease in pluricellular beings due to uncontrolled mitotic process :-
Q: 12. Which of the stated relationships is correct? A. the heart is superior to the large intestine B.…
A: This is a question related to choose the correct relationship. So it's related to human body…
Q: Tumor Necrosis Factor : they are lymphocytes arise from the lymphoid organs(bone and thymus) but…
A: Innate immunity is the immunity that we are born with and is present by birth. while adaptive…
Q: Identify the parts on the picture at the top. [ DNA, Chromosome, Tumor Suppressor, Proto-Oncogene,…
A: * Chromosomes are thread like structures which can be found inside the nucleus of animal and plant…
Q: Calculate the coulomb energy for the following three nuclei using the semi-empirical mass formula.…
A: Introduction The semi-empirical mass formula is used to calculate an atomic nucleus' mass and other…
Q: What is the uncontrolled mitotic process that occurs as disease in pluricellular beings called?
A: The uncontrolled division of mitotic cells is called neoplasia. Neoplasia (the formation of new…
Q: Bioprospecting – Research Conservation Product(s) -Income
A: Bioprospecting, also known as biodiversity prospecting, is a systematic and organized search for…
Q: The blood corpuscles are of kinds.
A: This question is based on types of blood corpuscles in the body.
Q: A. What type of abnormality is shown in Lois' karyotype and explain why she does not have a genetic…
A: Introduction A karyotype is the number and appearance of the complete set of chromosomes in the…
Q: Alleles are
A: A gene is the basic physical and functional unit of heredity.
Q: Compare and contrast exons and introns
A: Introduction - Noncoding regions of an RNA transcript or the DNA encoding it that are spliced off…
Q: 1. Why do waterfowls posses an intromittent organ that is highly elaborated? 2. What happens if you…
A: Answer :- 1)Intromittent organ in waterfowl by determining the relationships between intromittent…
Q: the area pellucida and area opaca.
A:
Q: Which of the following statements best describes artificial selection as an important mechanism of…
A: Evolution is defined as the change in traits over a period of time which make advanced form from…
Q: Species A is present in a community. Species B is introduced to the community. Over the next year,…
A: Interactions between two species A and B :-
Q: Narcolepsy is thought to occur from dysfunction of neurons located in the hypothalamus hippocampus…
A: Introduction - Narcolepsy is a persistent sleep condition marked by excessive daytime sleepiness and…
Q: - What effect does high temperature have on the fluidity of the plasma membrane?
A: as per our company guidelines we are supposed to answer only first 1 question. Kindly repost other…
Q: Use the table to answer the question. Classification of Selected Mammals Kingdom Animalia Animalia…
A: Classification is the process by which anything is grouped into convenient categories. In living…
Q: When considering genetic health, who should decide which genes are harmful or beneficial?
A: "Genes" are the fundamental unit of heredity. They store genetic information in the form of DNA,…
Q: Cellular reprogramming and induced pluripotent stem cells have allowed scientists to model various…
A: The stems cells are the specific cells which can be able to produce a complete plant or animal by…
Q: One similarity between carbohydrates and kids is they both…
A: * Carbohydrates are sugar molecules and it is one in three main nutrients found in foods and drinks…
Q: d) draw a chart of the fat metabolic pathway in adipocytes and explain how the hormone stimulates…
A: Adipocytes are the fat-storing cells also known as lipocytes. Mesenchymal stem cells give rise to…
Q: What is the purpose of the 5' cap and poly a tail
A: mRNA produced from transcription requires modifications to become active for translation process.…
Q: Bully whippets are homozygous for a deletion of two base pairs in the myostatin gene. This deletion…
A: Deletion is defined as the removal of bases from the nucleotide sequence of a gene.
Q: Monograph about ants
A: Introduction Ants are eusocial insects of the family Formicidae, belonging to the order Hymenoptera.…
Q: Organisms made during reproductive cloning will have the same genetic and personality traits of the…
A: Cloning is a process which has been used in biology for a long time to study various elements of the…
Q: What is the structure and Characteristics of Gymnosperms and its representative plants?
A: Plants are predominantly the photosynthetic eukaryotes belonging to the kingdom Plantae.…
Q: Please answer and explain. Provide references if possible: TOPIC: STAINING FECAL SMEARS 1.) What…
A: Direct fecal smears are generally valuable for the identification of protozoal parasites which have…
Q: It was observed during the early 20th century that the abscission zone of leaves of tree growing…
A: Solution Weakening of abscission zone was caused by ethylene ( gaseous plant growth regulator).…
Q: 3. In the sports camp, a group of students have been intensively swimming in a pool for 120 minutes…
A: Answer :- Various changes are made when a person is exercising specially in the mode of carbohydrate…
Q: Adding supplemental light of which of these colors would be most effective in reducing the growth…
A: * plants need sunlight for performing photosynthesis. * Photosynthesis is the process by the plants…
Q: HIV (human immunodeficiency virus) infections are difficult for the immune system to fight because.…
A: HIV virus is very prevalent in our world and it causes a disease known as acquired immuno deficiency…
Q: X-ray Irradiation is A. Chemical mutagen B. Physical mutagen C. Cosmetics agent D.…
A: Mutagens are chemical compounds or forms of radiation (such as ultraviolet (UV) light or X-rays)…
Q: Cellular reprogramming and induced pluripotent stem cells have allowed scientists to model various…
A: Pluripotent stem cells are the cells which can be developed into any type of the cell in the body .
Q: Drosophila can have 1, 2, or 3 stripes on their body. From previous experiments, you suspect that…
A: Introduction Drosophila melanogaster is a species of fly in the family Drosophilidae. The species is…
Q: A cell that proceeded to cell division without completing S phase would: O have extra ribosomes have…
A: Answer :- (D) not have enough DNA to divide normally
Q: Use the graphs to answer the question below. In each of the figures, the x-axis represents time, and…
A: Answer :- Option (D) is correct. - Graph D.
Q: A beneficial dominant mutation is expected to take fewer generations to reach high frequency than a…
A: There are few important points: A population genetics is the study of changes in the frequencies of…
Q: . It's possible that a bone tumor will not show up on an x-ray ) image but will show up in a gamma…
A: Cancer is the leading cause of death worldwide, according to the World Health Organization (WHO).…
Q: Alter death, calcium pumps no longer fünction and the calcium ion concentration of muscle fiber…
A: * After death of an animal or organism the calcium pump stops hence calcium should not be pumped and…
Q: A researcher that uses mouse models to understand protein function in the immune system ,genetically…
A: INTRODUCTION Genetic Engineering Genetic engineering uses rrecombinant DNA technology to alter the…
Q: Inhibiting the uptake of IAA (the IAA anion) into cells will have a smaller effect on gravitropic…
A: Answer The above statement regarding auxin IAA- is true
Q: Which sentence accurately describes the International Classification of Diseases (ICD) O It focuses…
A: *ICD means International Classification of Disease. It provides method of classifying diseases and…
Q: If instead of 20 amino acids there were 200 amino acids, then how many nucleotides would you be…
A: An mRNA directs the insertion of single amino acid to a protein per three nucleotides. A codon is a…
Q: Draw and label parts of whole mount of chick embrogenesis specimens of the following stages:…
A:
Q: 2. The four phases of the cell cycle, in order, are are G,, S, G,, and M. A cell contains the most…
A: The cell cycle is composed of interphase (G₁, S, and G₂ phases), followed by the mitotic phase…
Q: Chargaff's rule applies to: Group of answer choices A. only RNA B. both DNA and RNA C. only DNA…
A: INTRODUCTION chargaff's rule This rule state that the purine and pyrimidine bases of DNA of any…
Q: Mark has an autosomal recessive condition called sickle cell anemia, a serious blood disorder that…
A: Sickle cell anemia is an autosomal recessive disorder which ne it can only expression if present in…
Step by step
Solved in 2 steps
- These are written as either accurate or contain errors. Rewrite each one with an error as an accurate statement. Please have an explanation. Thank you! In eukaryotes RNA polymerase binds to the activator, specifically at the TATA box to align with the translational start site. Transcription Factors can have more than one function domain. One is the DNA-binding domain and the other is a trans-activation domain. Additive alleles function at one gene to contribute to the phenotype of an organisms, while non-additive alleles at that one gene do not add to the phenotype.The following diagram represents one of the Christmas-tree-like structures shown in Figure On the diagram, identify parts a through i. Q. Possible location of a terminator5'GGT ACG TTG GGG CTC CAT3' This sequence is transcribed and translated. Write the resulting amino acid sequence using the 3 letter code. Write the answer in a all capital letters. Leave a space between the amino acids. Do not write 5' and 3'. 5'GGT ACG TTG GGG CTC CAT3' This sequence is transcribed and translated. If the G in Bold changes to a T, then the result will be A) A nonsense mutation B) A frameshift mutation C) A silent substitution D) A missense mutation 5'GGT ACG TTG GGG CTC CAT3' This sequence is transcribed and translated. If the G in Bold changes to a A, then the result will be A) A nonsenese mutation B) A frameshift mutation C) A silent substitution D) A missense mutation
- Which is the odd one out ? For the rest, explain the concept/process/technique they are involved with. TFIIA TFIID TATA Box TFIIB CAG/CAASearching the yeast Saccharomyces cerevisiae genome, researchers found approximately 4,000 DNA sites with a sequence which could potentially bind the yeast transcription factor GAL4. GAL4 activates the transcription of galactose genes. Yet there are only 10 GAL4-binding sites which control the genes necessary for galactose metabolism. The GAL4 binding sequence is CGGAT#AGAAGC*GCCG, where # is T, C or G, and * is C or T. In one chromatin immunoprecipitation experiment (ChIP), yeast growing on galactose were lysed, and subjected to cross-linking reagents which cross-linked transcription factors and activators to DNA. Next the DNA was sheared into small fragments, and antibodies to GAL4 were added. These antibodies coprecipitated the GAL4 and the DNA it was cross-linked to. The cross-linking was then chemically reversed, and the DNA was isolated, cloned into a library of plasmids and sequenced. Results showed that only 10 different DNA sequences had GAL4 bound. Since the…I didnt get answer for this Can you explain in a few sentences how the change in the structure of the gene affects the function of the corn plant?
- Which of these epigenetic changes could lead to reduced transcription of a particular gene? Please make sure to select all correct answer options. decreasing acetylation of histones associated with the nucleosomes of that gene inducing histone modifications that allow the formation of denser nucleosomes in the regulatory region of the gene Oincreasing acetylation of histones associated with the nucleosomes of that gene repositioning the nucleosomes associated to the gene to expose the enhancer and promoter DNA of the gene Uremoving histones to expose the enhancer and promoter DNA of the geneWhy is the ErbB family pathway an important pathway for researchers that target cancer therapy. explain in 3-5 sentences.This question is regarding the 6 areas that can be involved in the control of gene expression: Part 1 - Using the image below, indicate where the six major control points for eukaryotic gene expression are on the figure (Letters A - F). Part 2 - Please give a brief description of what is occurring at each point or the specific molecule(s) for letters A- F. 1. Control Point A 2. Description of A 3. Control Point B 4. Description of B 5. Control Point C 6. Description of C 7. Control Point D 8. Description of D 9. Control Point E 10. Description of E 11. Control Point F 12. Description of F
- Below is a DNA sequence of the coding strand for a small gene. This gene has no introns. +1 5'- TATAAGATGCGTAGGATGCAGCTGTTTCAGCAGCCACGGTCTCGGCCCAGATAGCAGATAATAAACACGC GTA-3 a. Is this gene for an eukaryote or a prokaryote? Give one reason (. b. How many amino acids are expected to be coded by this gene? c. There are five underlined nucleotide sequences, interpret the purpose of three of them ONLY?The sequence of the lac promoter and two mutant promoters (Mutn 1 and Mutn 2) are shown below. The activity of these promoters is measured by fusing the them to the gene for Green Fluorescent Protein (GFP) and measuring the production of green fluorescence by GFP protein. What would you expect the GFP signal to be higher, lower or same for mutant promoters. Mutn 1 (enter higher, lower or same) Mutn 2 (enter higher, lower or same) - 42 ? ? +1 Lac CCAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGA CCAGGCTTAAAACTTTATGCTTCCGGCTCGTATGTTGTGTGGA Lac Mutl Lac Mut 2 CCAGGCTTTACACTTTATGCTTCCGGCTCGTATAATGTGTGGAThis is a paper centrifuge: (you don't need to watch the whole video, just a few seconds to see how it works--description below is probably sufficient if you can't get to the link) https://www.youtube.com/watch?v=isMYGtCFljc It is a paper disc that has supercoiled strings through two holes in the centre--like a button. As you straighten the strings and uncoil them, the paper spins. The paper spins at a very high rate and can separate materials in a way that is similar to a centrifuge. A droplet is added to the centre of the paper and it is spun. The densest objects travel the farthest from the centre. Assume that we are using it to perform our mitochondrial extraction, which cellular component would travel the furthest? nuclei mitochondria microvessicles blood cells