Q: Certain genes determine sex, fertility, and viability in Drosophila, and mutations in these genes…
A: Drosophila shows various gene expressions in sex differences. They show sexual dimorphism in gene…
Q: Certain people are able to taste the chemical phenylthiocarbamide (PTC) when it is present in wet…
A:
Q: Whether the statement "The normal gene function is required for the viability of the zebrafish." is…
A: The physical and as well as functional unit is used to define the heredity is the gene. They usually…
Q: You can choose one or more than one option During an experiment with Drosophila, it was…
A: Introduction: Thomas hunts morgan and his colleagues for the experimental verification of the…
Q: Hemophilia is an X-linked recessive genetic disorder found in humans. If a male child exhibits…
A: Hemophilia is an uncommon disorder in which the blood does not clot properly due to a deficiency in…
Q: Traditional gene mapping has been applied successfully to a variety of organisms including yeast,…
A: Genetic mapping is a method to identify exactly which chromosome has which gene and exactly showing…
Q: Duchenne muscular dystrophy is a serious condition caused by a recessive allele of a gene on the…
A: X linked disease Those diseases which are linked to X chromosome of an individual and pass through…
Q: which genetic disorder matches below descriptions deltetion of part of the Parm of chromosome 5.…
A: It refers to a health problem that can be caused by one or more abnormalities in the genome or by a…
Q: In man, muscular dystrophy is a condition in which the muscles waste away during early life and may…
A: Muscular dystrophy is a disease that involve a progressive loss of muscle mass and consequent loss…
Q: If a gene is located on the X chromosome of a mammal,it isa. expressed only in females.b. expressed…
A: X-linked recessive traits are expressed more likely in males as they have a single copy of X…
Q: The picture below represents a G1 cell from a newly discovered species that uses the X/Y sex…
A: Chromosomes can have different shapes on the basis of the position of the centromere.
Q: Imagine we identify a gene that is directly responsible for the effects of vasopressin on male…
A: The genetic constitution of every individual is almost similar except for few sites called small…
Q: Red-green color blindness in humans is due to an X- linked recessive gene. thin
A: Red-green color blindness is the most common variety of color deficiency in humans. It happens to…
Q: The direction of shell coiling in the snail Lymnaea peregra (discussed in the introduction to this…
A: Conchology deals with the study of formation and patterns of conch and shells. Its a part of…
Q: In humans, hemophilia is an X-linked recessive gene and will only be expressed in females if they…
A: Hemophilia is an inherited disorder where blood doesn't clot properly due to loss of body's capacity…
Q: The following system models the exchange of nutrients between mother and fetus in the placenta:…
A: The mechanism below simulates the flow of nutrients between the mother and the fetus in the womb.…
Q: The combination of genes present in the cells of anindividual is called the ___________.
A: Genes are part of DNA molecule that determines the genetic characteristics of an organism. Genes…
Q: In chickens, a key gene involved in sex determination has recently been identified. Called DMRT1, it…
A: The Sex-determination system determines the development of characteristics of sexual aspects in…
Q: males, are encoded by different alleles of the same X-linked fur color gene. Based on the phenotypes…
A: As we know that in XY -chromosomal system of sex determination , both X and Y chromosomes are sex…
Q: The direction of shell coiling in the snail Lymnaea peregra (discussed in the introduction to this…
A: Conchology deals with the study of formation and patterns of conch and shells. Its a part of…
Q: In chickens, a key gene involved in sex determination has recently been identified. Called DMRT1, it…
A: SRY gene in humans is involved in the expression of a protein which is involved in male sexual…
Q: The direction of shell coiling in the snail Lymnaea peregra (discussed in the introduction to this…
A: Among the given option, option (b) is the least appropriate or not correct.It is because a single S+…
Q: In humans, the ability to digest lactose beyond childhood is determined by a single gene on…
A: The diploid organisms contain two alleles for a particular gene. According to the mendelian…
Q: In mice, the A allele causes agouti fur, the AY allele causes yellow fur and is dominant to the A…
A: Mutations are alterations in the DNA sequence of an organism. Small changes, such as adding or…
Q: Removing the patch of tissue called the ZPA from one limb bud and placing into onto another…
A: ZPA is a zone of polarising activity, gives molecular signaling during limb formation in…
Q: If a Drosophila larva is missing much of its posterior end it is likely due to a mutation che: A.…
A: Since you have a question with multiple sub-parts, we solve the first sub-part for you. To get the…
Q: On the left side of this figure, explain why the offspringdoes not have Prader-Willi syndrome but…
A: Genomic imprinting is a phenomenon of marking a gene with the information regarding the parental…
Q: What will be the effect on sexual development in newly fertilized Drosophila embryos if the…
A: In Drosophila, sex determination is achieved by a balance of female determinants on the X chromosome…
Q: The beach mouse (Peromyscus polionotus) is a small rodent found in the southeastern United States.…
A: Introduction An organism's genotype is made up of all of its genetic components. The alleles or…
Q: The direction of shell coiling in the snail Lymnaea peregra (discussed in the introduction to this…
A: Two strains of Limnaea peregra or water snail are there that differ each other in the direction of…
Q: The beach mouse (Peromyscus polionotus) is a small rodent found in the southeastern United States.…
A: The average number of offspring per parent of a specific kind can be used to calculate absolute…
Q: In humans, the gene for tongue rolling (R) is dominant to non-rolling (r). A man homozygous for…
A: Since you have asked multiple question, er will solve the first question for you. If you want any…
Q: Using Figure 22.6, indicate the stage at which segmentation genes, homeotic genes, and egg-polarity…
A: The fruit fly has several genes which regulate the development of different structure at different…
Q: The direction of shell coiling in the snail Lymnaea peregra (discussed in the introduction to this…
A: The undeveloped organism is framed when a female gamete joins with a male gamete. In by far most of…
Q: ILH1 gene is located on chromosome 3 in humans, and four different alleles have been identified. The…
A: Humans are diploid organisms because they have two alleles at each genetic locus, with one allele…
Q: sexually reproducing animal has two unlinked genes, one for head shape (H) and one for tail length…
A: Gametes contain one allele of the whole gene. So possible genotypes of gametes is HT only
Q: Which of the following is NOT true regarding Hox genes. A) The sequence they appear in their…
A: Hox genes: Hox genes are a group of similar genes that define parts of an embryo's structure along…
Q: mutation in the TCOF1 gene causes up to 93% of Treacher Collins syndrome cases. This gene, which is…
A: Treacher Collins syndrome is caused due to either a mutation on the TCOF1 gene present on chromosome…
Q: Colorblindness is an X-linked trait found in humans. What are the chances that a colorblind man will…
A: Colorblindness is a recessive disorder located on the X chromosome. Since, it is recessive, two…
Q: Give the sex of the following organisms, assuming that the autosomes are present in the normal…
A: answer given below
Q: Genetic maternal effect is often seen in mammals. For example, research shows that the maternal…
A: In genetics, a maternal effect occurs when a mother's genotype is expressed in the phenotype of her…
Q: True or False: Follicle cells on the dorsal side of the Drosophila embryo produce the Backless…
A: The follicles, which are hollow balls of cells containing immature eggs, are present in the ovaries…
Q: Discuss how and why x - linked inactivation alters the genome of a female.
A: Sex determination in humans In humans, sex is determined by the number of "X" chromosomes. The males…
Q: Explain whether the statement "The normal gene function is required for the viability of the…
A: Explain whether the statement "The normal gene function is required for the viability of the…
Q: Which of the following statements regarding X inactivation in eutherian mammals is FALSE? X…
A: X-inactivation (Lyonization) is an interaction by which one of the duplicates of the X chromosome is…
Q: Discuss the concepts of: "MORPHOGENESIS" Also, cite examples to illustrate these concepts.
A:
Q: The direction of shell coiling in the snail Lymnaea peregra (discussed in the introduction to this…
A: The given statement that Martha's genotype cannot be s+s+ is false.
Q: There is a gene in sand sharks that determines whether or not there is an anal fin. If a male sand…
A: Genetic characteristics of an organism are known as genotype, and physical characteristics due to…
Q: In marsupials, X inactivation occurs exclusively to paternally derived chromosomes. Which genes will…
A: Inactivation of the X chromosome is of two types - random X chromosome inactivation and imprinted X-…
Each of the vertebrate Hox genes is present in 4 copies of the genome (TRUE or FALSE)
Step by step
Solved in 2 steps
- For each of the following, identify whether the statement about Hox genes is true for Drosophila only, vertebrates only, or both Drosophila and vertebrates. Hox genes are present in the genome. Both Drosophila and vertebrat v Different hox genes are expressed in [Choose ] body segments along the anterior- posterior body axis. Duplication has resulted in several hox [Choose] gene clusters in the genome. Hox genes are expressed after gap [Choose ] genes and pair-rule genes.Below are the DNA sequences that encode the first eight amino acids for five alleles of the Adh protein in Drosophila pseudoobscura. Nucleotides that differ from the first sequence are shown by a lowercase letter. ATGTCTCTCACCAACAAGAACGTC ATGgCTCTCACCAACAAGAACGTC ATGTCgCTCACCAACAAGAACGTC ATGTCTtTgACCAACAAGAACGTC ATGTCTCTCACCAACAAGAACGTg a. What are the first eight amino acids for each of these five DNA sequences? b. For each of the five polymorphic sites, indicate whether the site represents a synonymous or nonsynonymous polymorphism. c.The fourth sequence shown above has two mutational differences from the first sequence. Specifically, the third codon is TTG versus CTC in the first sequence. These two codons are two mutational steps away from each other. Supposing that the CTC sequence gave rise to the TTG sequence, do you think it is more likely that the one-difference intermediate was TTC or CTG? d. In general, synonymous polymorphisms tend to be more common than nonsynonymous…Which of the following statements regarding X inactivation in eutherian mammals is FALSE? X inactivation may occasionally occur in males (tried this answer but marked wrong) This process produces a uniform phenotype in heterozygous females The process appears to be random X inactivation occurs early in embryonic development
- Certain genes determine sex, fertility, and viability in Drosophila, and mutations in these genes affect the two sexes differently. Classify the descriptions below based on their occurrence in XY or XX flies. Some descriptions may be used in both categories. The expressed form of Dsx activates maleness genes and represses femaleness genes. XY XX Null mutations in the dsx gene result in an intersex phenotype. Loss-of-function mutations in the tra gene have no effect on phenotype. Sxl is expressed in early embryogenesis from the establishment promoter. Flies that produce Fru-M in brain cells from a transgene perform a mating dance and specifically court females. Loss-of-function mutations in the fru gene result in flies who court both males and females. Sxl regulates splicing of its own RNA to produce a functional protein. The expressed form of Dsx activates femaleness genes and represses maleness genes. Loss-of-function mutations in the Sxl gene have no effect on phenotype. ResetLid (Little imaginal discs) is a gene located on chromosome 2L and FRT40A refers to an FRT sequence inserted at the 40A (cytological location). Tubulin (Tub) refers to a promoter that can drive target gene expression in all the cell types. Gal80 is an inhibitor of Gal4 that blocks Gal4’s ability to activate transcription. Determine whether the following statements are true or false for flies with the following genotype: y w HsFLP; lid, FRT40A / P{Tub-Gal80}, FRT40A; P{Tub-Gal4} P{UAS-GFP} / + A. The fly will express Gal4, which will activate GFP in all the somatic cells without heat shock. B. After heat shock, FLP recombinase will be induced, which will induce mitotic recombination at FRT40A. However, lid mutant clone will be not induced because it is located closer to the centromere than FRT40A. C. After heat shock, FLP recombinase will be induced, which will induce mitotic recombination at FRT40A, resulting in the generation of homozygous lid mutant clones and twin spots that are…Bicoid is a maternal-effect gene in the fruit fly Drosophila that controls anterior/posterior axis formation. Recessive mutations in bicoid can result in fly larvae that have no head, and thus are embryonic lethal. bcd+ is the wild type bicoid allele bcd is the recessive mutant bicoid allele A cross between two heterozygous parents (bcd+/bcd) results in all wild-type F1 offspring. 1. What are the possible genotypes and ratios of each genotype in the F1 offspring of this cross? 1. How can you explain the fact that all the F1 offspring are phenotypically wild-type, using what you know about maternal-effect genes?
- Which of the following is an example of conditional specification? Multiple Drosophila nuclei division without cellularization of blastomeres Destroying one half of a 2 cell stage Xenopus embryo and subsequent loss of half the embryological structures Separation of sea urchin blastomeres resulting in individual pluteus larva development Differentiation concentration of paracrine factors within the embryo cytoplasmThe genes in your lung cells can also be found in your muscle cells. True FalseWhich of the following statements regarding X-inactivation is TRUE?(posted) Inactivated X chromosomes are only found in somatic cells of females. After X-inactivation happens in a cell, all daughter cells resulting from mitotic events of that cell will have the same X chromosome ina none of the statements listed here are true X-inactivation is a random event that happens during human development right before a fetus is born. all of the statements listed here are true)
- Due to evolutionary forces, the genes of insects and mammals have diverged functionally. True FalseWhich of the following is an example of autonomous specification? Multiple Drosophila nuclei division without cellularization of blastomeres Destroying one half of a 2 cell stage Xenopus embryo and subsequent loss of half the embryological structures Differentiation concentration of paracrine factors within the embryo cytoplasm Separation of sea urchin blastomeres resulting in individual pluteus larva development O o oChorionic villus sampling (CVS) is used to test for genetic disorders in the fetus and can be performed early in gestation (8-10 wks). The recommended method of CVS is to sert a probe with a needle on the end through the cervix and remove a small sample of e chorionic villi to be analyzed. Which description is a correct description of chorionic villi? Select one: They are found in the digestive tract of the fetus. They are developed from the endometrium. They contain cells whose nuclei differ genetically from cells of the fetus. They form part of the placenta.
