During which one of the following phases of the cell cycle does the nucleus divide? O Interphase O G2 phase OS phase G1 phase M phase

Q: G6PD deficiency is an X-linked recessive disorder. When people who have this disorder eat fava beans...

A: An X-linked trait is regulated by the genes present on the X chromosomes.

Q: The petals of the plant Collinsia parviflora are normally blue, giving the species its common name, ...

A: Part A. The F1 cross progeny are blue in color and this denotes that they are dominant.   In the F2 ...

Q: The energy available to do work in a cell is called: a. thermal energy b. potential energy c. ...

A: Introduction :  thermal energy - every objects has thermal energy.  It's the movement of molecules w...

Q: Test 6- Comparing the DNA (Gene) Code for Dopamine Active Transport Protein Once dopamine triggers a...

A:   Here,  human DATP gene sequence of human is given , i.e :  ATTCCGGATCGATATCGCCGGATATACTCCGGTAATATC

Q: Genotype frequency of two alleles have been calculated to be p = .2 and q = .8 Is this population of...

A: C. Not enough information to calculate this.

Q: H* ions generated by reactions in the electron transport chain, as well as H* ions present in the ma...

A: * Electron transport chain are sequential process of reactions occurs in mitonchondrial innermbrane ...

Q: Starches with a branched structure are called O polymers O granules O amylose O amylopectin

A: Amylopectin  The non-crystallizable form of starch, consisting of branched polysaccharide chains. I...

Q: What is the formula for net primary production (NPP)? How does NPP relate to energy pyramids?

A: Introduction In this question we have to write the formula for net primary production (NPP) and have...

Q: Klinefelter syndrome (XXY) can most be easily diagnosed by_______ . a. pedigree analysis c. karyotyp...

A: Introduction:- Klinefelter syndrome (KS) is a hereditary disease in which a male's genetic code cont...

Q: comprise the membrane. If you isolated a single transmembrane helix from a protein from this strain,...

A: Since the newly identified bacteria has normal nucleic acids and proteins - the amino acids in the p...

Q: Which of the following statements about cancer is correct? A. Cancer stem cells can make tumors resi...

A: Cancer is a disease that occurs when the cells in the body start dividing abnormally. They go out of...

Q: Aside from Dengue Fever what other diseases can Aedes aegypti carry? Give 3

A: Aedes Aegypti is known to transmit following pathogens: - Yellow Fever Virus: - Causes Viral diseas...

Q: The placenta is your unborn baby's life support system and plays a key role in its development. Ans...

A: The placenta is a vital organ that plays a crucial role in fetal development. Without it, the fetus ...

Q: Define oxidation in carbohydrate metabolism. What are the roles of NAD+ and FAD+ in carbohydrate met...

A: Carbohydrate metabolism It is defined as the biochemical processes through which the metabolic forma...

Q: If  I extract a cell culture with 100 cells that just entered g1.  I needs to extract the MOST possi...

A: Introduction: Cell cycle is the process by which a cell replicates i.e. makes copies of itself or fo...

Q: . An allele A that is not lethal when homozygous causes rats to have yellow coats. The allele R of a...

A: Gregor Mendel, also known as the "Father of Genetics," was the first to propose the concept of genes...

Q: List the four main types of organic compounds found in living systems, and identify which of these a...

A: All the living organisms are made up of cells and each and every cell of the body is made up by a or...

Q: What is "Patient Access" for a biotech? How does it differ from "Market Access"?

A: Basically, the 'Patient access" for biotech defines the availability of any product from biotechnolo...

Q: Identify the parts of the heterotrimeric G-protein shown in the image. B

A: Introduction :- G proteins, also known as guanine nucleotide-binding proteins, are a group of protei...

Q: How does the vegetal stratification of an ecosystem influence its biological diversity?

A:     Stratification in the field of ecology refers to the vertical layering of habitat. The arrangeme...

Q: Describe the three stages of transcription?

A: Introduction :  Synthesis of mRNA by using  DNA as a template strand  is known as transcription. It ...

Q: 21. What are two ways by which SARS-CoV-2 disguises itself from detection by its host-cell's immune ...

A: SARS CoV 2 is a RNA virus, members of large family of virus called corona virus. This virus mainly i...

Q: Question 3. An abnormally high levels intracellular tangles are observed to occur in the brains of p...

A: Q3.Tangles are seen in the cytoplasm of dead and dying nerve cells.  They are composed of twisted st...

Q: Describe the various post-translational modifications of HIF- 1alpha and how it affects the regulati...

A: Describe the various post-translational modifications of HIF- 1alpha and how it affects the regulati...

Q: Tay–Sachs disease is caused by recessive alleles on anautosome. In which case(s) could two parents w...

A: Dominant allele is one that always expresses its phenotype. Recessive allele is one that is expresse...

Q: Marfan syndrome (Section 13.5) is inherited in an autosomal dominant pattern. What is the chance tha...

A: Introduction:- Marfan syndrome is a connective tissue disorder caused by a genetic mutation. Mutatio...

Q: In the absence of oxygen, the cell's ability to convert glucose into ATP is

A: Anaerobic respiration is sometimes is also known as fermentation, it is a metabolic process in which...

Q: Using appropriate examples, describe some of the ways thatgenetically engineered microorganisms are ...

A: Genetic engineering modifies the genome of organisms.  

Q: QUESTION 2 The final step in gene expression is protein synthesis, or a. translation b. transcriptio...

A: Introduction :- The process of making protein molecules is known as protein synthesis. It includes a...

Q: 7. How is Genomics different from genetics? *

A: Since you have asked multiple questions, we will solve the first question for you. If you want any s...

Q: Can the amount of available energy on a given trophic level be larger than the available energy on l...

A: Answer 

Q: Write and submit a lab report showing any relationship between blood pressure readings of your class...

A: Introduction:- Blood pressure is a measure of the force that your heart uses to pump blood around yo...

Q: Starches can be defined as indigestible saccharides

A: Starch is the carbohydrate that is composed of many glucose molecule units that arr joined together ...

Q: Determines the order of the four chemical building blocks - called "bases" - that make up the DNA mo...

A: A nitrogenous base is a molecule with the chemical characteristics of a base and contains nitrogen. ...

Q: What is the common feature of RTKS: O cysteine rich domains SS binding of external proteins O trysos...

A: Tyrosine kinase domain

Q: Hello, good day. I have a problem answering this question, and I need your help. Hoping for a respon...

A: Physical features of Aedes aegyptiAedes aegypti is a small, dark mosquito that mosquitoes are distin...

Q: How can a large amount of biological diversity protect an ecosystem from environmental damage? Why a...

A: Introduction In this question we will discuss about how large amount of biological diversity can pro...

Q: Human Karyotype B (questions #7 to #12) 7. The diploid number is 46. 8. The haploid number is 23 onl...

A: Karyotype: A karyotype is a collection of all metaphase chromosomes in a species' or individual orga...

Q: why Humans have respiratory structures from the gut, for fishes, they’re not

A: * most fishes exchange oxygen and carbon dioxide in wate with the help of gills. *Beside the gills t...

Q: Of the choices below, pick the answer that best characterises pulsatile flow: O In pulsatile flow, r...

A: The best characteristic of pulsatile flow is- In pulsatile flow, red blood cells must deform to pas...

Q: Which senses are mentioned in the following sentence? "I went outside and felt the cool breeze on my...

A: The sensory nervous system helps us receive the environmental signals and then decode them by sendin...

Q: the 1940’s, a young actress filed a case against a film director, Robin Williams, for parental suppo...

A: Introduction:- The presence or absence of the antigens A and B, which are carried on the surface of ...

Q: Muscle fatigue has been suggested as one factor that can increase the chances of non-contact sports ...

A:  * Anterior cruciate ligaments found inside knee joint.which cross each other to form an "X"  shaped...

Q: What is the purpose of using an “outgroup” when reconstructing a phylogenetic tree? (Write 4 points)

A: The outgroup is used as a point of comparison for the ingroup and specifically allows for the phylog...

Q: Describe what the early atmosphere was like and what cause a large amount of oxygen (O2) to build up...

A: Early atmosphere  Around 4.6 billion years ago, the Earth was formed from a heated mixture of gases ...

Q: What were Founding bioethicists studying?

A: Bioethics is an interdisciplinary branch that merges biological studies and human/moral values. It i...

Q: Would the Meselson and Stahl experiment have workedif diploid eukaryotic cells had been used instead...

A: Meselson and Stahl are known for discovering the semiconservative mode of DNA replication. They perf...

Q: When did concern over the effects of pesticides start to grow in the United States? Describe the arg...

A: The term pesticide is associated with a biological or chemical agent that has the ability to impact ...

Q: The part of the neuron that is usually highly branched and receives input from other neurons is the ...

A: Neurons are a particular form of cell that carry information messages or signals to and from the bra...

Q: Two albinos marry and have four normal children. Howis this possible?

A: Introduction Albinism is a genetic condition that causes a person's skin, hair, and eyes to be excee...