Muscle fatigue has been suggested as one factor that can increase the chances of non-contact sports injuries, such as anterior cruciate ligament (ACL) tears. Notably, some researchers have noted a delay in the reflex response after muscle fatigue. With your understanding of the stretch reflex, which of the following is the most logical contributing factor to the injury? a. the distraction of the game causes inhibitory impulses to be sent down from the somatosensory cortex, so muscles are not operating at full capacity b. the proprioceptors adapt and become less sensitive c. there is an increase in time to muscle contraction after triggering a reflex

Q: What are the Rule of Independent Events, the Product Rule, and the Sum Rule. Define single nucleotid...

A: These rules are used in biology to classify events and explain the difference in various events  SNP...

Q: The efficiency (in terms of increased outputs from fewer inputs) of modern industrial agriculture is...

A: With evergrowing population and constant land and other resources, the production per hectare needs ...

Q: With reference to Fig. 5.1 discuss the factors which lead to people living under severe water stress...

A: The natural water resources are responsible for supplying water for various activities such as agric...

Q: Why have we chosen a human Rab protein with no direct yeast equivalent as an “outgroup” for this stu...

A: Rab protein: it plays important role in recruitment of organelle specific vesicles tethering factors...

Q: During the Paleozoic, many life forms developed hard parts (shells/bones/etc.).  Why would it be use...

A: Shelled animals, the majority of which are sea-based, come in a wide range of shapes and sizes. Beac...

Q: Black body (b) and purple eye (pr) are recessive autosomal mutations in Drosophila. Bridges are cros...

A: b - allele for black body - recessive pr - allele for purple eye - recessive B - wild type for body ...

Q: What is the climax stage of an ecological succession?

A: Introduction:- Ecological succession is the process that describes how the structure of a biological...

Q: Test 6- Comparing the DNA (Gene) Code for Dopamine Active Transport Protein Once dopamine triggers a...

A:   Here,  human DATP gene sequence of human is given , i.e :  ATTCCGGATCGATATCGCCGGATATACTCCGGTAATATC

Q: Q6.1. What is the founder effect? Sampling error that occurs during the establishment of a new popul...

A: Introduction :- The founder effect is the loss of genetic variation that happens when a new populati...

Q: Four E. coli strains of genotype a*b¯ are labeled 1, 2, 3, and 4. Four strains of genotype a¯b* are ...

A: ANSWER;-  HFR is the high-frequency recombination cell F+ is the donor cell whereas F- is the recipi...

Q: A blood culture from a patient is taken for analysis. The potentially diseased blood is then analyze...

A: Some Established methods in pathogen detection are Polymerase chain reaction (PCR), culture and colo...

Q: 3. What would be the optimum pH for pepsin, an enzyme that breaks down protein in your stomach? Why?

A: ANSWER) The optimum pH for enzyme Pepsin is 2. At 2 pH Pepsin exhibits maximal activity.

Q: How did the scientific community learn that DNA replication takes place in a semi-conservative fashi...

A: DNA replication is the process by which DNA makes exact copies of itself.  Several models of DNA rep...

Q: Feral cats in Australia I read they are insaive species causing harm to wild life? What harm can the...

A: Feral cats are mainly untamed and unowned cats that mostly live in the wild and avoid socialization....

Q: There are two figures- one for vector control plate & another PCRinsert+vector experimental plate.  ...

A: We know that genetic selection of transformed or transfected cells is one of the significant step of...

Q: Describe the hair and give the components

A: Hair Thin elongated keratinized structures present over almost all of the body surface hair is forme...

Q: With the cladogram below as a basis, answer the following questions in the space provided. 6. Write...

A: Cladogram is a diagrammatic illustration in which relationship of taxons with each other and with an...

Q: Q:-What is neoplasia?

A: Introduction In this question we will discuss about the Neoplasia.  

Q: 1-true tissues or not- who does not have? 2- radiate/bilateria- who for sure is in radiate? 3- diplo...

A: Kingdom Animalia / metazoa The kingdom Animalia is classified into Two Sub Kingdoms , they are -  P...

Q: A woman will give birth to a quadruplets without knowing the gender. What is the probability of havi...

A: 1.Given,              Quadruples are born.And the total possible outcomes are 2 power 4 i.e16. And t...

Q: human cheek cells

A:

Q: 10. What is Relative Centrifugal Field (RCF, in g's) in a centrifuge with a rotor radius of 10 cm sp...

A:  

Q: Look at the equation for photosynthesis and try to explain a basic overview of the process of photos...

A: Photosynthesis  It is defined as the process through which plants use the sunlight to convert the li...

Q: Explain in your own words: What are the unique anatomical structures observed in birds to carry out ...

A: Introduction:- Avian gastronomy is as diverse as that of mammals, resulting in classifications such ...

Q: how does an organism maintains homeostasis through the interaction of the various organ systems in t...

A: Homeostasis, from the Greek words for "same" and "steady," refers to a self-regulating process by wh...

Q: You have a precursor protein that is translated in the cytosol with an N-terminal mitochondrial loca...

A: The mitochondria is a double membrane bound cell organelle that is responsible for energy (ATP) prod...

Q: A blood culture from a patient is taken for analysis. The potentially diseased blood is then analyze...

A:   Presence of alcohol in body can be done by foreign invaders like bacteria yeast and other microorg...

Q: What are cerebrovascular accidents?

A: Introduction In this question we will discuss about the cerebrovascular accident

Q: CHOICES: 36 72 18 9 144   If a gamete of an unknown animal species has 18 chromosomes, 1. how many c...

A: 1. Gamete of any species have half the total number of the chromosomes of that of the organism in th...

Q: In Figure 6-21, propose a specific genetic explanationfor individual Q (give a possible genotype, de...

A: Examples of diseases showing an incomplete penetrance are Huntington's disease and breast cancer. Bo...

Q: What determine what molecule will act as the predominant electron acceptor in a sediment layer? a. t...

A: *Microorganisms present on subsurface environments competes for electron donors and acceptors . *As ...

Q: Why are GMOS considered a threat to the environmental safety?

A: Introduction In this question we have to discuss why GMOs considered a threat to the environmental s...

Q: Provide a description of the plant cell of plastids in leaf of Hydrilla observed under high power ob...

A: Hydrilla is a hardy, fast-growing perennial with long, slender stems that can reach a length of 7 me...

Q: What is the purpose of using an “outgroup” when reconstructing a phylogenetic tree

A:

Q: cloning an organism ethical

A:

Q: Which of the following statements accurately describes the pattern of recruitment in a muscle when p...

A: The contraction of muscle is responsible for the development of muscle movement. The generation of s...

Q: What will guide them to make the right decision?  Do they have a choice?

A: Answer: 1.trophobalst or icm if cells choose to become they will end up in the placenta and if they ...

Q: A 17-year-old boy visits his physician with com- plaints of recurrent bouts of dizziness, palpita- t...

A: The correct option is D Lyme disease

Q: What is chimera in recombinant dna How we can make chimeric gene Is chimeric gene is related to gmo ...

A: Recombinant DNA (rDNA) is a technique for copy and pasting DNA sequences of interest using enzymes. ...

Q: What is myocardial infarction (a heart attack)?

A: Myocardial infarction is determined as a heart attack which results from the blockage of flow of blo...

Q: Where do spindle fibers attach on a chromosome? O cell plate O meristem centromere

A: The chromosomes can be described as the thread like structures that can be found in the nucleus of t...

Q: True or False. The binding affinity between a peptide agonist and its specific G protein coupled rec...

A: Introduction:- Intermolecular interactions such as ionic bonds, hydrogen bonds, and Van der Waals fo...

Q: What are persistent organic pollutants (РOPS)?

A: Introduction In this question we have to write about the persistent organic pollutants.  

Q: Assume for simplicity that height is a discrete characteristic that is affected most strongly by a s...

A: Dutch populations have highest height in entire world. 

Q: Hello, good day. I have a problem answering this question, and I need your help. Hoping for a respon...

A: Mosquito repellent: the chemicals that repels the mosquito away. 

Q: Meaningful evolution occurs when __________. ○ a heritable trait affects survival and fitness ○ a ...

A: Evolution is the change in the characteristics of a species over several generations and relies on t...

Q: Which of the following statements about the differential expression of human genes is correct?

A: There are three postulates of differential gene expression, two of which states that -  1. Every nuc...

Q: are the gene pairs in non allelic interaaction, recessive epistasis independently segragating?

A:  Epistasis:The interaction of genes that influence phenotype" Epistasis is a phenomenon in genetics ...

Q: During a car accident, Mrs. Tay loses a large amount of blood. How would this affect the process of ...

A: Introduction: Glomerular Filtration Rate or GFR is the rate at which the kidneys form the filtrate i...

Q: Pathogen A has an ID50 of 10 cells and an LD50 of 10,000,000 cells. Pathogen B has an ID50 of 10,000...

A: Given information Pathogen A ID50 of 10 cells LD50 of 10,000,000 cells Pathogen B ID50 of 10,000 ...

Muscle Action

A change in the body or a bodily organ as a result of its functioning is referred to as an action. Muscle action can be defined as the specific movement of a bodily part generated by the contraction of a muscle. The muscle proteins actin and myosin are the important contractile proteins involved in muscle action. Muscle contraction, in addition to movement, serves several other important functions in the body, including posture, heat generation, and joint stability. Muscle contraction maintains posture, which includes standing and sitting.