Question 3. An abnormally high levels intracellular tangles are observed to occur in the brains of patients suffering from several fatal neurodegenerative diseases like Alzheimer's disease. These tangles are composed of protein that has an unusually high level of which post-translational modification?

Describe the effect of this mutation on the amino acid sequence of the beta-gloving polypeptide chain: effect of mutation on codon, which amino acid was changed (#amino acids from beginning of chain), what was the amino acid change (from which amino acid to which amino acid?) also find the reputable published source to support this information

18. Amino acids at the N-terminal end of eukaryotic polypeptides that contain information required for post-translational processing and determining the extra-cellular destination of the nascent polypeptides. Group of answer choices 1. Sigma Sequence 2. Signal Sequence 3. Chaperone Sequence 4. Kozak Sequence

QUESTION 2 Shown here is a DNA sequence. The promoter is highlighted in yellow and the terminator is highlighted in blue. Transcription begins 10 bases from the promoter. What are the first 7 bases of RNA? 5'-ATATTTGCTAGACTGTCGCTCCGATCTGTACTTGATGCGÂTTČGGATCCCCGCTCCGATCGTAGGAGATTGCTGTTTTAC-3' 3'-TATAAACCGATCTGACAGCGAGGCTAGACATGAACTACGCTAAGCCTAGGGGCGAGGCTAGCATCCTCTAACGACAAAATG -5' Promoter Terminator O ATATTTG O AUAUUUG O CTGTACT O CUGUACT O GACATGA O GACAUGA

39

Mutations I used: stop codon, insertion, deletion and substitution. Explanation please.

Because of the way the genetic code structured, a point mutation in a given codon is likely to have what impact on the meaning of that codon? Select all that apply. 1.It will always change the amino acid 2.It can never change the animo acid encoded 3.The amino acid encoded often will not change 4.The biochemical property of the amino acid encoded likely will not change 5.The biochemical property of the amino acid encoded will always change

8.4 Post translational modification The following diagram shows three different types of post translational modification that can occur in proteins. Proteolysis: Phosphorylation: Glycosylation: Cleaving of polypeptide chains The addition of phosphate groups to proteins The addition of sugar groups Label the diagram to demonstrate what type of post-translational modification has taken place to the protein chain. Translation Posttranslational processing eor What organelle is responsible for post translational modification?

Please offer an explanation for the correct answer

"I'm interested in learning about diverse post-translational modifications (PTMs) and their functional roles. Could you provide insights into several instances of PTMs along with explanations of their mechanisms?"