During translation, the mRNA template is read and amino acids corresponding to the codons are linked together. Use the labels on the left to identify the components of the image that are involved in translation. the growing polypeptide chain that becomes the new protein the mRNA transcript an uncharged tRNA that has been released from the E site a charged tRNA, carrying an amino acid the P site holds a tRNA with its amino acid bonded to the polypeptide chain the A site into which the charged tRNA will bind the ribosome ACC D CAD CAD ... GGG ▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬ a charged tRNA, carrying an amino acid AUG UAA „…▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬

Select the CORRECT sequence of sites that are involved in translation. A site, P site, E site E site, P site, A site P site, A site, E site A site, E site, P site

Select the features of a eukaryotic mRNA that are not encoded in the genome. Select all that apply. O Intron O Exon 5' Cap O Poly A tail Promoter O start codon

The following image depicts a short stretch of sequence associated with a gene. Which of the following is true?

Which one of the following options is NOT a step in RNA processing? Addition of the 5’ G cap Addition of the 3’ poly A tail Splicing to remove exons and connect the retained introns Splicing to remove introns and connect the retained exons

A __________ molecule is characterized by having a peptide-binding site, a modified 5’ guanine, and an anticodon.   _____________ molecules are encoded by multiple gene copies in both prokaryotes and eukaryotes, and they catalyze critical reactions functions during translation.  Group of answer choices mRNA; rRNA   rNA; aminoacyl tRNA synthase   tRNA; rRNA   rRNA; precursor RNA   mRNA; tRNA

If the gene undergoing protein synthesis consists of 24 bases, how many codons does that result in? How many amino acids will the protein consist of?

A scientist sequencing mRNA identifies the following strand: CUAUGUGUCGUAACAGCCGAUGACCCG What is the sequence of the amino acid chain this mRNA makes when it is translated? The genetic code has been provided for you below. Second letter U C A G UAU UACJ UAA Stop UGA Stop A UAG Stop UGG Trp UCU ) UUU) Phe UUC J UGU U UCC UGC, U UUA LE Ser UCA -Leu UUG, UCG CAU САС His CAA CAG Gln CUU CCU CGU CGC Arg CỤC ССС Leu -Pro CỦA ССА CGA CUG СCG CGG AAC FAS AAGLYS AUU ACU AAU AGU Asn Ser AUC ile AUA AUG Met| ACG AGC AGA Arg AGG J АСС - Thr АСА AAA GAU Asp GACJ Ala GAA GUU GCU GGU U GUC Val GUA GGC Gly GGA GCC GCA GAG Glu GGG GUG GCG First letter Third letter

The purpose of the tRNA in the P site is to: hold the growing polypeptide chain and transfer it to the A site Initiate translation termination stabilize the single strands of DNA

Which of the following would not be found in a mature mRNA in a eukaryotic cell? A Star Codon B Poly-A tail C Promoter D Exons