Give the sequence of the complementary DNA strand for the DNA chain with the following base sequence 5'-CTTGGATATC-3'
Q: Give the base sequence of the complementary DNA strand of the DNA chain with the following base…
A: DNA is a macromolecule composed of individual subunits known as nucleotides. Each nucleotide…
Q: Base on the coding strand of DNA: ATG GGA ATT CGC What is the sequence of the complementary…
A: DNA or DeoxyRiboNucleic Acid is a biomolecule which serves as a genetic material in number of…
Q: A template strand in bacterial DNA has the following base sequence: 5′ –AGGTTTAACGTGCAT–3′ What…
A: Bacterial DNA is contained within the bacterial chromosome along with several RNA and protein…
Q: E D A 11. Ligase is denoted by letter 12. The Okazaki fragment is denoted by letter . 13. The SSB…
A: DNA (Deoxyribonucleic acid) and RNA are two examples of nucleic acids (Ribonucleic acid).…
Q: Which of the following sequences would be complementary to a DNA strand with the sequence…
A: Complementarity refers to a relationship between two structures each following lock and key…
Q: Suppose the following base sequence was found in a 20-base DNA polymer. 3'CAG TTA AGG CTC CTA GGT TA…
A: DNA(deoxyribonucleic acid) is a double-stranded helical genetic material containing thousands of…
Q: Write the complementary DNA strand for the following DNA base sequence: 5' СТСААG 3' 3' 5'
A: Central dogma consists of replication, transcription and translation. Replication is the synthesis…
Q: Give the corresponding strand of the DNA having the sequence of: a. 5’…
A: DNA(deoxyribonucleic acid) is the heredity material for most living organisms. It is composed of…
Q: If one DNA strand is 5′–GGCATTACACTAGGCCT–3′, what is the sequence of the complementary strand?
A: DNA (deoxyribonucleic acid) was discovered by Friedrich Miescher. Nucleotides are the structural…
Q: Which of the following represents a missense mutation in the DNA coding strand sequence, 5' -…
A: A change in the structure of DNA, known as a mutation, can alter the sequence of amino acids that…
Q: Which strand was used to form the following amino acid. strand 3 "ATGGAATGTTTACCCGTATTATACGGATAGACG…
A: The four bases of DNA—the A, C, G, and Ts—are strung together in such a way that the cellular…
Q: A strand of DNA containing the repeating sequence TAC GCT TTT GCG ATAACT could code for which of the…
A: When DNA is converted into RNA then this is called transcription. When mRNA encodes protein then…
Q: If a sequence of one strand of DNA is 5'-TGACTATC-3', what is the complementary strand?…
A: DNA is a macromolecule and is composed of two complementary strands. Bonds which is formed between…
Q: Give the sequence of the complementary DNA strand for the DNA chain with the following base sequence…
A: Biomolecules are organic molecules made up of mainly carbon and hydrogen but there are other…
Q: Write the sequence of the complementary strand of the following portion of a DNA molecule: 5…
A: DNA (Deoxyribonucleic acid) is the primary genetic material for most life forms. However, certain…
Q: Write out the resulting DNA molecules after the following double stranded DNA molecule is digested…
A: DNA stands for deoxyribonucleic and. It is the genetic material present in the cell.
Q: Given the following sequence for one strand of a double-stranded oligonucleotide:…
A: Nucleic acids are of two types: RNA and DNA RNA It is referred to as ribonucleic acid. It is…
Q: Which of the following would be the correct complementary sequence to this strand of DNA: 5 ATTCGATC…
A: Question- Which of the following would be the correct complementary sequence to the strand of DNA…
Q: If the sequence of one strand of DNA is written as follows:5' -ATGCATGCATGCATGCATGCATGCATGC-3'Write…
A: The deoxyribonucleic acid is the genetic material that is passed from one generation to another…
Q: Draw the following strands of DNA 5’ C-A-T 3’ as well as the complementary base pairing strand…
A: Two strands of DNA twist around one another to form a double helix DNA and both are in anti-parallel…
Q: The DNA sequence ATGCATGC will pair with which of the following DNA strands? TACGTACG TACCTACC…
A: DNA, or deoxyribonucleic acid, is the hereditary material in humans and virtually all other…
Q: Give
A: Introduction:- The central dogma of biological sciences explains how genetic information is…
Q: One half of a DNA strand has the following sequence of bases GCTACGGCGTTATCCCC. What would appear on…
A: In a DNA molecule each deoxyribonucleotide is made up of a sugar, nitrogenous base and phosphoric…
Q: Match each DNA component to its corresponding point of attachment. 1. carbon 3' 2. carbon 5' 3.…
A: Deoxyribonucleotide (DNA) is a molecule containing all the genetic information needed to make each…
Q: Regarding the diagram below, this enzyme is responsible for creating an exact replica of DNA in one…
A: DNA replication is the process of replication of the DNA material in a semi-conservative manner.…
Q: One strand of a DNA helix has the sequence: 5'-ATTGCCGTC-3'. Write the sequence of its complementary…
A: A DNA helix is an antiparallel helix that is wound on each other. It consists of two complementary…
Q: Write the base sequence and label the 3' and 5' ends of the complementary strand for a segment of…
A: DNA is a duplex helical molecule, which has complementary base pairs. The complementary strands are…
Q: Create the complementary strand for the DNA strand. ATTTGGTT
A: DNA or the Deoxyribonucleic acid present in both eukaryotes and prokaryotes are made up of millions…
Q: Write the sequence of reverse compliment chain to this DNA sequence: CGTCCGCCCCGCGAGCACA…
A: Double stranded nucleic acids are formed through hydrogen bonding between complementary nitrogenous…
Q: Which of the following statements is true of double stranded DNA? The double stranded structure is…
A: DNA is stabilised by hydrogen bonds, base stacking interaction, hydrophobic force, ionic…
Q: For the following DNA sequence: 3’–CGATACGGCTATGCCGGCATT–5’ Write: a) the sequence of the…
A: Deoxyribonucleic acid (DNA) is a molecule with two chains of polynucleotides that wrap around one…
Q: Write the sequence of the DNA strand complementary to the following strand:…
A: DNA or Deoxyribonucleic acid is the double helical structure, present in each and every cell of all…
Q: Produce the complimentary DNA strand that would be matched with the provided strand T--A C--G C --G…
A: A complementary strand of DNA is constructed based on base complementarity. Complementarity is…
Q: A strand of DNA contains the base pair 5’-T-C-A-G-C-A-T-3’. Give the base sequence on the…
A: Answer
Q: A nontemplate strand of bacterial DNA has the following base sequence. What amino acid sequence will…
A: During transcription process, the strand used as template is known as template strand which sets in…
Q: (a) Provide the sequence of the DNA complementary to the following strand (please write it in the 3'…
A: Complementary DNA Complementary DNA (cDNA) could be a DNA copy of a mRNA (mRNA) molecule created by…
Q: Tabulate the differences of the various DNA conformations in terms of orientation, rise per base…
A: The DNA duples model proposed by Watson and Crick was right handed spiral known as B-DNA. apart from…
Q: Look at the image of the the dinucleotide (two nucleotides joined togethr in a single strand). Base…
A: Nucleotide are the basic building blocks of DNA. A nucleotide consists of a sugar, nitrogenous base…
Q: Show the replication strands in each of these bubbles (note they have different DNA orientations).…
A: DNA Replication Replication of DNA is a process of duplication of DNA, carried out by DNA…
Q: in DNA replication, if the template strand is 5’-ATCCGTGTAACCTT-3’, what is the sequence of the…
A: DNA strand is made up of 4 nitrogenous bases i.e adanine, thymine, guanine & cytosine.
Q: What is the sequence of the newly synthesize DNA segment if the template strand has the following…
A: A DNA refers to a helical structure that is made of nucleotides. A nucleotide comprises a phosphate…
Q: Describe the way in which DNA is folded. give at least 5 points
A: DNA or deoxyribonucleic acid is a biomacromolecule molecule that stores genetic information in most…
Q: One strand of a DNA molecule contains the base sequence 5'-ACTTGCCA-3'. Write its complementary base…
A: Two strands of DNA both are antiparallel and complementary to each other.
Q: Draw the full structure of the DNA strand: 5'-ATG-3' To the above strand, draw the complementary…
A: Nucleic acid are the macromolecules which are of two types :- DNA and RNA DNA is deoxyribonucleic…
Q: Complete the complement strand of DNA by providing the correct base pairs. Template Strand:…
A: DNA: The DNA molecule of all known animals and many viruses contain genetic instructions in the…
Q: Match the correct bases pairs to find the opposite strand of DNA strand of DNA - T G C…
A: DNA is deoxyribonucleic acid. It is the genetic material which is double stranded, which means it…
Q: DRAW IT In a DNA double helix, a region along oneDNA strand has this sequence of nitrogenous…
A: DNA is known as deoxyribonucleic acid. It is made up of two strands. DNA is made up of nucleotides.…
Q: How many hydrogen bonds are present in a DNA double helix fragment consisting of the following…
A: DNA is a nucleic acid molecule made of monomer units called nucleotides. The nucleotides forming DNA…
Q: Give the sequence of the complementary DNA strand of the DNA chain with the following base sequence:…
A: Deoxy ribonucleic acid is the double-stranded hereditary material that consists of sugar,…
Q: Fill in the blank with the most appropriate term that is described by the following statement:…
A: The components of DNA replication. A five-membered, oxygen-containing ribose sugar ring with three…
Give the sequence of the complementary DNA strand for the DNA chain with the following base sequence
5'-CTTGGATATC-3'
Step by step
Solved in 4 steps
- Give the base sequence of the complementary DNA strand of the DNA chain with the following base sequence: 5’ ACGTAG 3’This is part of the Escherichia coli DNA sequence that contains an inverted repeat. (Note: top strand is the coding strand). 5'-AACGCATGAGAAAGCCCCCCGGAAGATCACCTTCCGGGGGCTTTATATAATTAGC-3' 3'-TTGCGTACTCTTTCGGGGGGCCTTCTAGTGGAAGGCCCCCGAAATATATTAATCG-5' (i) Draw the structure of hairpin loop that will be formed during the end of transcription. (ii) Describe the function of the hairpin loop during transcription.Given the sequence shown below, write the complementary DNA sequence, using the base-pairing rules, as well as the directionality of the strands: 5'- CGAGGCTAGGTTAACCTG-3'
- Write the base sequence and label the 3' and 5' ends of the complementary strand for a segment of DNA with the following base sequences: 5'CGGAC3'This is part of the Escherichia coli DNA sequence that contains an inverted repeat. (Note: top strand is the coding strand). 5'-AACGCATGAGAAAGCCCCCCGGAAGATCACCTTCCGGGGGCTTTATATAATTAGC-3' 3'-TTGCGTACTCTTTCGGGGGGCCTTCTAGTGGAAGGCCCCCGAAATATATTAATCG-5' Draw the structure of hairpin loop that will be formed during the end of transcription.Here is a DNA coding strand’s sequence and direction: 5’-ATGCCGATATAG-3’ . What would be the amino acid sequence in the polypeptide encoded by this DNA?
- Given the DNA template strand 3' GCATTCAAG 5', write the amino acid sequence in the N‑terminal to C‑terminal direction. Note: Enter the amino acids using their three-letter designations. Put a hyphen between each amino acid.Write the sequence of reverse compliment chain to this DNA sequence: CGTCCGCCCCGCGAGCACA TGTGCGCGCGGGGCGFor the following DNA sequence: 3’–CGATACGGCTATGCCGGCATT–5’ Write: a) the sequence of the complementary DNA strand
- What is the nucleotide sequence of the complementary strand of the DNA molecule: 5’-AATGCGATCTTCAT-3’? Indicate the 5’ and 3’ ends. Follow the same format as the given sequence.Write down the double stranding sequence of the resulting DNA fragment(s) if the following DNA molecule were digested with XhoI: 5'-GGTATCCGCGGAGCTCAAATA-3' 3'-CCATAGGCGCCTCGAGTTTAT-5'Draw and label the following RNA tetranucleotide: 5’phosphoryl-A-2’O-methyl-C-U-G-3’-phosphate