Q: hat kind of cells are suitable for flow cytometric analysis and why?
A: FCM is an approach for identifying and quantifying the physical and chemical properties of a cell…
Q: Shh is expressed in the most posterior location of the limb bud and works in concert with FGF…
A: Answer : Shh is found in the posterior region. If shh is deleted or inhibited there will be…
Q: A body is found submerged with the facial bones exposed, torso with some bone exposure, and bones of…
A: The stage 4 of decomposition i.e. skeletonization is the condition here as per the given…
Q: Which of the following labels corresponds to the adrenal glands? D B WH A OA B OC OD OE OF E F E
A: In the above diagram of the kidney the part that corresponds to adrenal gland is D . The adrenal…
Q: product of this type of cell division? Indicate the number of dauahter cells, the TYPE OF CELLS…
A: Cell division can be either mitosis or meiosis. Meiosis is a cell division that produces the gametes…
Q: A)What does the arrow point to? B)What is the function of the structures the arrow points to? KU…
A: Epithelial cells are found throughout the body such as lining the surface of the skin, hollow…
Q: Assuming that no new mutation was present in their daughter, offer a genetic explanation for her…
A: Haemophilia is an X linked recessive disorder. In such cases, males (XY) With one copy of defected…
Q: 1. Which of the following sequences shows the correct hierarchy of classification, going from the…
A: To determine: To determine the given hierarchy of classification from most inclusive to the least…
Q: Microscopes Assignment
A: as per our company guidelines we are supposed to answer only first 3 question. Kindly repost other…
Q: Within a cell, the complete breakdown of glucose to generate ATP occurs by two fundamentally…
A: Ques : Within a cell, the complete breakdown of glucose to generate ATP occurs by two fundamentally…
Q: 1. Explain in full the mechanism of apoptosis in cells with severe DNA damage that cannot be…
A:
Q: Which two traits on the gene map below for the fruit fly are most likely to cross over together?
A: The physical crossing over during meiosis of parental heterozygous homologous chromosomes or genes…
Q: An electrode was placed on a neuron and the voltage across the membrane was measured as the neuron…
A: Neurons are the structural and functional units of the nervous system. They perform the task of…
Q: TOXICOLOGY HELP: What are two common toxicology related developability issues encountered during…
A: Toxicology can be defined as a discipline of science dealing with poisonous substances which on…
Q: a. Explain how figures 3 and 5 are connected. Does this support the hypothesis proposed by Parent…
A: Resistance Resistance is defined as the ability of an organism to avoid the attack of a compound or…
Q: You are being approached by a bear in the woods. Unlike what you may have heard, you do not want to…
A: Autonomous Nervous system The autonomous Nervous system is a division of the peripheral nervous…
Q: Describe briefly what happens in each step.
A: Step 1) Denaturation:- In this step there is a proper unfolding of the genomic DNA and subsequent…
Q: If you got rid of the endostyle of an ascidian, what is most likely to occur? A. no gas exchange…
A: Endostyle: It is a logitudinal ciliated groove on the ventral wall of pharynx which produces mucus…
Q: Which of the following conditions will result to deactivation of a gene? a. histone methylation b.…
A: In this question we have to describe about regulation of genes . See full answer in step 2.
Q: Number of Asci MI or MII for ser? MI or MII for thr? Tetrad Type 1 ser thr ser thr ser+ thr+ ser+…
A:
Q: Create a concept map linking hemoglobinopathies to the molecular foundations of these diseases and…
A: In this question we have to make a concept map of the disorder sickle cell anemia. See full answer…
Q: Define and compare a bacteriophage lytic cycle and lysogenic cycle.
A: ANSWER) Lytic cycle of bacteriophage is the cycle in which the cellular mechanism on the host cell…
Q: Given a positive genetic correlation between the lengths of the maxilla and the mandible of a bird…
A: Positive correlation and pleiotropic effects.
Q: What kind of systems have been developed to detect CSCs? Describe by giving examples. Please explain…
A: Cancer stem cells are a very small number of cells in the tumor responsible for tumor growth.
Q: There are three main subsystems to a flow cytometer. Describe the primary function of each one in a…
A: Flow cytometry is basically an bioinstrumental technique which is implicated to detect and quantify…
Q: The twofold cost of sex model by John Mynard Smith explains how - A. asexual females can become…
A: ANSWER) (A) Asexual females can become predominant in a population. The twofold cost of sex model by…
Q: If a diploid organism has 14 chromosomes (2n=14) a. How many chromosomes will its gametes have?…
A: Introduction: Meiosis is type of cell division which results into the four daughter cells each…
Q: Describe the general characteristics of mollusks. Describe the general characteristics of annelids.…
A: The main characteristics of Invertebrates are they lack backbone. Invertebrates are various types…
Q: Explain how the disease effects the conduction of information and what class of neurons appears to…
A: Multiple sclerosis has no recognised aetiology. It's classified as an autoimmune illness since the…
Q: When presenting a phylogenetic tree, researchers will often indicate the level of bootstrap support…
A: Bootstrap values in a phylogenetic tree indicate how many times, out of 100, the same branch is…
Q: appropriate way to write an APA format paper?
A: APA format APA format or the American Psychological Association format is a format of official…
Q: The following graph shows the AMPA/NMDA ratio in cells from rats that were either: naive, unpaired…
A: NMDA and AMPA are one types of glutamate receptors mainly present in neuron.
Q: Read the paragraph that follows on a particular GMO. Make a tabulation of its use's positive and…
A: Genetically modified organism (GMO) is an animal plant or microbe whose DNA has been altered using…
Q: Two gene loci, A and B, are on separate chromosomes and alleles A and B are dominant over alleles a…
A: Dihybrid cross Is a mating experiment involving two creatures that are genetically identical in two…
Q: In a sorting flow cytometer, what are the deflection plates used for?
A: Flow cytometry: Flow cytometry (FC) is a technique for detecting and quantifying the physical and…
Q: LI - II HIII X H
A:
Q: One DNA strand has the sequence 5' -ATTCCGTAGC-3' what is the complementary strand sequence?
A: DNA ( Deoxyribonucleic acid ) is two stranded structure which act as genetic material in most of the…
Q: Human chromosome 11 GC content is 42%. What is the percentage of each nucleotide on chromosome 11?
A: According to Chargaff rule,- in DNA there is always equality in quantity between the bases A and T…
Q: In a newly discovered species of Giant Pacific Octopus, long tentacles (L) are dominant to short…
A: Each chromosome is made up of two sister chromatids, each of which contains the same genetic…
Q: In the following pedigree of an X-linked recessive trait, which of the numbered individuals MUST be…
A: X linked trait are the disease related to the sex chromosomes or can be called the X chromosome .And…
Q: Question 8. Assuming that the differences in moth density are due to toxicity differences, which of…
A: Resistance Resistance is defined as the ability of organisms to grow against the effect of a…
Q: The wet nose and clipped upper lip of the ___ does not allow these primates the range of facial…
A: The taxonomic classification of Kingdom Animalia has classified the mammals into various different…
Q: Q3. Using the mutated DNA parental template sequence, follow it through to the resulting polypeptide…
A: The gene or small portion of DNA undegoes transciption to form mRNA and then this mRNA undergoes…
Q: 2 events that happen in meiosis that do not happen in mitosis and explain what happens during these…
A: In this question we have to describe about cell division . See full answer in step 2.
Q: Identify the chaperone proteins that facilitate peptide binding to newly synthesized MHC I proteins…
A: MHC or Major Histocompatibility Complex. MHC is a group of genes that code for proteins found on…
Q: On the gel shown below are four DNA samples. Samples A to C are taken from tissues of landslide…
A: The gel electrophoresis is used to separate the DNA fragments according to their sizes. The smaller…
Q: In a phylogenetic tree, Species 1 and 2 are distantly related to one another but are both darkly…
A: Q. In a phylogenetic tree, Species 1 and 2 are distantly related to one another but are both darkly…
Q: The mandible lengths of the camellia weevil (used to break through the pericarp of the Japanese…
A: Answer-- antagonistic coevolution.
Q: Cancer stem cells (CSCs) are cancer cells (found within tumors or hematological cancers) that…
A: Cancer is a disease in which cells multiply abnormally, infiltrating, eroding, and killing healthy…
Q: (f) Parts of a Neuron A C E D H Synapse: The region where an axon terminal communicates with its…
A: Neuron is the fundamental units of brain and nervous system. Neuron consists of dendrites, soma and…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps with 1 images
- Assume the following portion of an mRNA. Find a start signal, and write the amino acid sequence that is coded for. 5'-GCCAUGUUUCCGAGUUAUCCCAAAGAUAAAAAAGAG 3'List the steps in the processing of a typical eukaryotic mRNA precursor to prepare it for its functional role.Describe how eukaryotic mRNA is processed
- draw mRNA sequence for the following sequence ATGGCCCTGTGGATGCGCCTCCTGCCCCTGCTGGCGCTGCTGGCCCTCTGGGGACCTGACCCAGCCGCAGCCTTTGTGAACCAACACCTGTGCGGCTCACACCTGGTGGAAGCTCTCTACCTAGTGTGCGGGGAACGAGGCTTCTTCTACACACCCAAGACCCGCCGGGAGGCAGAGGACCTGCAGGTGGGGCAGGTGGAGCTGGGCGGGGGCCCTGGTGCAGGCAGCCTGCAGCCCTTGGCCCTGGAGGGGTCCCTGCAGAAGCGTGGCATTGTGGAACAATGCTGTACCAGCATCTGCTCCCTCTACCAGCTGGAGAACTACTGCAACTAGYou may wish to consult the genetic code above to answer the following question. A mutation has changed a portion of a protein coding gene that encodes a messenger RNA sequence. The original messenger RNA sequence is 5-AUGCCCAGAGCU-3' Which mutation is a nonsynonymous (missense) mutation that changes a single amino acid in the encoded protein? O 5-AUGCCCAGGGCC-3' O 5'-AUGCCCUGAGCU-3' O 5'-AUGCCCACAGCU-3 5'-AUGCCCCAGAGCU-3The code for a fully functional protein is actually coming from an mRNA transcript that has undergone post-transcriptional processing which is essentially way too different from the original code in the DNA template. Given: GUC-CAC-UUA-ACC-CCU-GAG-GAG-AAA-UCG-GCC (Protein with known amino acid sequence) Requirement: Original DNA code. Itemize the steps you would take to get to know the original DNA code of the protein in focus.
- The set of mRNAs present within a cell changes over time.Explain.The amino acids, in one-letter symbols and no spaces, coded by the following mRNA sequence is 5’ AAUGGAACGUCGGUACUGCCAUCGCAUUAGUACCAUGGCAAGCUGAAGC 3’Below is the sequence of an mRNA that has just been transcribed. Please translate this sequence as if you were a ribosome, and write out the translation results. A genetic code table has been provided. mRNA: 5'- A C G U C C A A U G G C A G U G A U U U G A A U C C A -3'
- For the following mRNA sequences, what is the amino acid sequence formed? Consult genetic code table for reference. 5' AGUCCGUAC 3' 5' AAUUGCUUC 3'NASA has identified a new microbe present on Mars and requests that you determine the genetic code of this organism. To accomplish this goal, you isolate an extract from this microbe that contains all the components necessary for protein synthesis except mRNA. Synthetic mRNAs are added to this extract and the resulting polypeptides are analyzed: Synthetic mRNA Resulting Polypeptides AAAAAAAAAAAAAAAA Lysine-Lysine-Lysine etc. CACACACACACACACA Threonine-Histidine-Threonine-Histidine etc. AACAACAACAACAACA Threonine-Threonine-Threonine etc. Glutamine-Glutamine-Glutamine etc. Asparagine-Asparagine-Asparagine etc. From these data, what specifics can you conclude about the microbe’s genetic code? What is the sequence of the anticodon loop of a tRNA carrying a threonine? If you found that this microbe contained 61 different tRNAs, what could you speculate about the fidelity of translation in this organism?Translation is the process by which the sets of 3 bases (codons) of the mRNA are read to specify the sequence of amino acids for the protein to be produced. Using the genetic code data provided, find the sequence of amino acids that would correspond to the MRNA codons shown. Codons 1 3 MRNA A UGUGGAUC CGAG UCACG Amino acid SECOND LETTER A U UUU Phenylalanine UCU UCC Serine (S) UAU Tyrosine (Y) UAC TAA stop codon UAG stop codon UGU Cysteine (C) UGC TỮA Leucine (L) TGA stop codon UGG Tryptophan (W) F UCA UUG UCG I H CUU CCU CAU Histidine (H) R CGU CỨC Leucine (L) CỦA CCC Proline (P) ССА CCG CGC Arginine (R) CGA CAC "CAA Glutamine CAG (Q CUG CGG G D A AUU L AUC Isoleucine (1) AAU Asparagine AAC (N) ÄÄÄ Lysine (K) AGU Senine (S) ACU ACC Threonine ACA (T) AGC E AUA AGA Arginine (R) E ACG T AUG stat codon (M) AAG AGG TG GƯỮ GAU Apartic acid GAC (D) "GAÄ Glutamic acid GCU GGU GUC Valine (V) GUA GGC Glycine (0) GCC Alanine (A) CE GCA GGA R GUG GCG GGG GAG (E) The start codonencodes the amino…