DNA polymerases cannot initiate synthesis of a polynucleotide; they can only add nucleotides to the 3`end of an existing polynucleotide. False True   Replication of DNA is (????), meaning that when DNA is replicated each strand becomes a template for the new strand. Semiconservative Conservationist Neoconservative

In DNA Replication, what is the function of Primase: works to connect discontinuous parts of DNA such as the nicks created by gyrase and the okazaki fragments O Synthesizes RNA on a DNA template to provide an available 3'-OH group to continue with DNA synthesis O binds at the origin and begins to unwind the helix O bind near the origin to maintain the complementary sequences of DNA from reforming the helical structure

Which of these molecules could be incorporated into a primer during DNA replication? Select all that apply

During DNA replication, DNA polymerase adds nucleotides to the: 3' end of the newly synthesized strand as it moves toward the 3' end of the template strand 3' end of the newly synthesized strand as it moves toward the 5'end of the template strand 5' end of the newly synthesized strand as it moves toward the 5' end of the template strand 5' end of the newly synthesized strand as it moves toward the 3' end of the template strand none of the above 0 0 0 0 0

DNA strand  1 (template) TACATGCTCGTGACTTTT  Mutation in strand 1 TACATGTCGTGACTTTT DNA Strand 5 (template) TACAGGTGTTCCCAGATCGGG Mutation in DNA strand 5 TACAGGTGTTCCCATATCGGG 1.use the original (template) strand of DNA to find the correct amino acid sequence in the DNA. 2.find and highlight the mutation in the DNA. 3.Find the new sequence of the amino acids for the protein in the new mutated strand of DNA. 4.Determine if this mutation is a point mutation of a Frame shift Mutation. 5.Determine if it is a silent mutations, Missense mutation, Nonsense mutation, Insertion or Deletion. 6.will this new protein function the same as the old protein? Why or why not?