Certain environmental conditions such as exposure to UV light areknown to activate lysogenic λ prophages and cause them to progressinto the lytic cycle. UV light initially causes the repressor protein to be proteolytically degraded. Make a flow diagram showing the subsequent events that lead to the lytic cycle. (Note: The xis gene codes for an enzyme that is necessary to excise the λ prophage from the E. coli chromosome. The enzyme integrase is also necessary for this excision.)

Certain environmental conditions such as exposure to UV light areknown to activate lysogenic λ prophages and cause them to progressinto the lytic cycle. UV light initially causes the repressor protein to be proteolytically degraded. Make a flow diagram showing the subsequent events that lead to the lytic cycle. (Note: The xis gene codes for an enzyme that is necessary to excise the λ prophage from the E. coli chromosome. The enzyme integrase is also necessary for this excision.)

Curren'S Math For Meds: Dosages & Sol

11th Edition

ISBN:9781305143531

Author:CURREN

Publisher:CURREN

Chapter16: Adult And Pediatric Dosages Based On Body Surface Area

Section: Chapter Questions

Problem 7.2P

See similar textbooks

Similar questions

Bacteriophage lambda is integrated in DNA of a host cell, which is exposed to UV light in a body of water in the environment. Describe the sequence of events that occurs in its life cycle. Briefly describe the role of the Lambda repressor (cI) and cII activator to regulate the switch between the lysogenic and lytic cycles of phage Lambda.
Bacteriophage λ, after infecting a cell, can integrateinto the chromosome of the cell if the repressor protein, cI, binds to and shuts down phage transcriptionimmediately. (A strain containing a bacteriophageDNA integrated into the chromosome is called a lysogen.) The alternative fate is the production of manymore viruses and lysis of the cell. In a mating, a donor strain that is a lysogen was crossed with a lysogenic recipient cell, and no phages were produced.However, when the lysogen donor strain transferredits DNA to a nonlysogenic recipient cell, the recipientcell burst, releasing a new generation of phages. a. Why did the mating with a nonlysogenic recipientresult in phage growth and release, but the infectionof a lysogenic recipient did not?
M13 is a filamentous phage that infects the bacterium Escherichia coli. Infection with M13 is not lethal. However, the infection causes turbid plaques in E. coli because infected bacteria grow slower than the surrounding uninfected bacteria. This phage has been engineered to act as a vector system. Explain how the amplification of gene of interest works in this phage with illustration.
The following is a sequence of the leader region ofthe his operon mRNA in Salmonella typhimurium.What bases in this sequence could cause a ribosometo pause when histidine is limiting (that is, when thereis very little of it) in the medium?5′ AUGACACGCGUUCAAUUUAAACACCACCAUCAUCACCAUCAUCCUGACUAGUCUUUCAGGC 3′
I have this strain of e coli. Is P+ o+ Z+ Y+ / I- P+ oC Z- Y+ Will beta-galactosidase and permease be expressed? If they are will they be inducible or constitutive?
Use the blanks on the left hand side to put the following statements in order (use numbers or letters to designate the order). All of the statements refer to the diauxic (sequential) growth of a bacterium on the carbon substrates glucose and lactose (see textbook Fig 4.11 on diauxic growth). Remember, the lac operon contains the genes necessary for the lactose catabolism. The glucose substrate is completely consumed, at which time the repressor protein on the lac operon unbinds from the DNA molecule. The lactose substrate is catabolized by the active B-galactosidase enzyme. Glucose, as the preferred carbon substrate, is first consumed by catabolic enzymes that are constitutive (always present). After completion of translation, the B-galactosidase enzyme undergoes folding to form into an active enzyme that can breakdown lactose into its constituent monosaccharides. The messenger RNA code from the lac operon is translated by ribosomal RNAS to form lac-related enzymes, such as…
After a cell "clears" the G₁ restriction checkpoint, it can proceed into S phase. This S phase entry is achieved by a cyclin dependent kinase (Cdk2) and its cyclin (Cyclin E), but additionally requires the action of a protein kinase (CDC2) as well as a phosphatase (CDC25) enzyme. Explain how these 4 proteins work together to orchestrate S phase entry.
The following statement occurs early in this chapter:“. . . a crucial step in the regulation of many bacterialgenes is the binding of RNA polymerase to DNA atthe promoter.” Why might it be advantageous forbacteria to regulate the expression of their genesat this particular step?
Repressor protein controlling own regulation in Lamda lysogenic cycle, justify with the following presentation.
Inhibitors for this reverse transcriptase fall in two classes: nucleoside analog inhibitors (NRTIs) or non-nucleoside analog inhibitors (NNRTIs). NRTIs have a similar structure to nucleosides and block the active site of the reverse transcriptase, whereas NNRTIs don't look like nucleosides and bind to an allosteric pocket in the reverse transcriptase. Presently NNRTIs are used more often than NRTIs, as NRTIs have more severe side effects. Why do you think NRTIs would have severe side effects?
Some people have a genetic predisposition for developing priondiseases. Examples are described in Table 25.6. In the case ofGerstmann-Straüssler-Scheinker disease, the age of onset istypically 30–50 years, and the duration of the disease (whichleads to death) is about 5 years. Suggest a possible explanationwhy someone can live for a relatively long time withoutsymptoms and then succumb to the disease in a relativelyshort time.
As shown a genetic switch that controls the choicebetween the lytic and lysogenic cycles of phage λ. What is agenetic switch? Compare the roles of a genetic switch and a simpleoperator site (like the one found in the lac operon) in generegulation.