Boring magasanik collected data on the proportion of each base in RNA  from different species. To compare the relative amount of each base, he standardized thr value of adenine to 10. Relative amounts of other bases were calculated based on this value for adenine. For each of the listed body parts listed, give the proportion of purine to pyrimidines in a decimal form. Rat liver nuclei Rabbit liver nuclei Cat brain

Q: Calculate the number of phosphates, deoxyribose and ribose, and nitrogenous bases needed for a:…

A: Nucleic acid can be of 2 types: DNA (deoxyribonucleic acid) RNA (ribonucleic acid)   DNA carries…

Q: Erwin Discovered That A- the number of adenines is always equal to the number of guanines, and the…

A: The American organic chemist Erwin Chargaff (1905-2002) found that DNA is the essential constituent…

Q: If the nitrogen-based molecules present in the DNA of an animal are found to be 22.7% thymine…

A: DNA  DNA is a long tread like structure present in the nucleus of an eukaryotic cells. DNA is…

Q: Indicate the relative size of each of the following, using "1" for the largest, most inclusive…

A: A nucleotide is formed by nitrogenous base, sugar and phosphate. Commonly found bases in DNA and RNA…

Q: Why can you not create a Ramachandran plot for RNA molecules? Is it possible to get a similar type…

A: Ramachandran plot is plot that describes the distribution of torsional angles called phi and psi of…

Q: Deoxyribonucleic Acid (DNA) and Ribonucleic Acid are the two main nucleic acids. In all living…

A: Nitrogenous bases are heterocyclic and water insoluble molecules. These nitrogenous bases are two…

Q: Draw the structure and give the name of a nucleotide made of adenine (A) and deoxyribose.

A: Nucleic acids are made up of nucleotide monomers that are polymerized to create long strands. The…

Q: Which of the following are true statements about DNA and RNA? Select all that apply. RNA contains…

A: DNA and RNA are nucleic acids which are the most important biomolecules in all living organisms. DNA…

Q: RNA differs from DNA in that: a) The ribose in RNA nucleotides contains fewer oxygen atoms than does…

A: DNA = Deoxyribonucleic acid is a polymer. Which is composed of two polynucleotide chain. That chain…

Q: Part of being a detective is being able to decode secret messages left behind by certain…

A: The given DNA sequence is: 5'- TATGCTAGGCATTGTCGTAGGCATACG -3' 3'- ATACGATCCGTAACAGCATCCGTATGC -5'

Q: A) Draw the structure and give the name of a nucleotide made of G + ribose. B) Write the…

A: Ribonucleic acid (RNA) is a polymer of ribonucleotides that participate in diverse biological roles…

Q: Experiments have demonstrated that the "words" of the genetic code (the units that specify amino…

A: The genetic code is a set of rules that specifies how the information in DNA and RNA molecules is…

Q: Draw the structure of the dipeptide Thr-Cys at pH7. Clearly indicate the following

A: Disclaimer: As per Bartleby guidelines, for questions with multiple sub parts, we will answer only…

Q: Determine the effect of the following mutations on the DNA sequence. In each case, the mutation is…

A: Proteins are important for the normal functioning of the human body. Proteins are made of amino…

Q: Sketch a pyrimidine nucleotide subunit that would be found only in RNA. Circle and label the three…

A: RNA is a polymer composed of nucleotides attached via phosphodiester bonds. RNA is found as genetic…

Q: Below is a graphic with 8 blanks. Please assign each arrow a number corresponding to the words in…

A: DNA (deoxyribonucleic acid) is the genetic material in living organisms that is composed of two…

Q: Draw and label the dinucleotide AT as follows: A. 5’ and 3’ ends B. Phosphodiester bond C.…

A: Introduction:- Phosphodiester bonds make up the backbones of DNA and RNA. The phosphate is attached…

Q: A molecule has the following percentages of bases: A= 42%, C = 14%, G= 21% and T=23%. Which of the…

A: Correct option is single stranded DNA i.e. option 2 is correct .

Q: The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to…

A: Replication is the process of the formation of identical copies of DNA. It takes place in the…

Q: Name two enzymes/protein complexes in molecular biology that contain both RNA and protein. What…

A: A molecular assembly consisting of both protein molecules and enzymatic components is referred to as…

Q: There is only one possible sequence of amino acids when deduced form a given nucleotides. But…

A: Nucleotide refer to a biomolecule composed of phosphate, pentose sugar and nitrogenous base. These…

Q: During planetary exploration a new life form is discovered which has a DNA genome containing 6…

A: A genetic code is defined as the blueprint for the synthesis of proteins. Normally, three nucleotide…

Q: In an attempt to understand whether viruses rely on proteins or nucleic acids to transmit their…

A: The present knowledge of DNA's function in heredity has resulted in a wide range of practical uses,…

Q: If the nitrogen-based molecules present in the DNA of an animal are found to be 16.3% adenine…

A: A, T, C, and G are the four nitrogenous bases. Adenine, thymine, cytosine, and guanine are the four…

Q: (a) Write the complementary base sequence for the matching strand in the DNA section shown below:.…

A: Introduction According to Chargaff's rules, DNA from any cell of any organism should have a 1:1…

Q: Choose any pentapeptide composed of five different amino acids.  List the amino acids.  Present one…

A: INTRODUCTION In cells, messenger RNA is a molecule that transports information from the nucleus to…

Q: here is a chemically synthesized DNA oligonucleotide is 5’–AUCG–3’. Please draw the all-atom…

A: DNA contains nitrogenous bases A, T, G and C while RNA contains A, U, G and C.  RNA is synthesised…

Q: Suppose that there is a protein consisting of two polypeptide chains with the given sequences in the…

A: Edman degradation, which was invented by Pehr Edman, can be used to determine the amino acid…

Q: Calculate the number of amino acids encoded by a DNA sequence of 27 nucleotides.

A: Deoxyribonucleic acid is a molecule composed of 2 polynucleotide chains that coil around one another…

Q: Given the following sequence of nucleotides of a template DNA strand, predict the sequence of mRNA…

A: The DNA nucleotide sequence given above is- 3' CGTACGCCGAGACGTCAAC 5' (Template DNA strand) The mRNA…

Q: Explain the importance of Chargaff's rules and the complementary nature of nucleotide bases.

A: Erwin Chargaff proposed Chargaff’s rule. Chargaff’s rule played important role in the discovery of…

Q: Using the DNA figure below to identify structures of the following letters: A= B= C= D= E= F: Circle…

A:

Genome annotation

The technique of linking biological information to genome sequences is termed genome annotation. Gene annotation is the method of identifying gene locations and coding sections. It helps us understand what these genes are doing in the body through establishing structural characteristics and linking them to the actions of various proteins.