In RNA, an atypical base pair is able to form between guanine and uracil. This base pair allows a single tRNA molecule to recognize more than one codon using its one anticodon sequence. It requires a shift in position of the two nucleotides. Guanine and uracil come together in this unusual pair via 2 hydrogen bonds. Based on what you know about hydrogen bond formation and base pairing, draw a guanine nucleotide and a uracil nucleotide hydrogen bound to one another.

In RNA, an atypical base pair is able to form between guanine and uracil. This base pair allows a single tRNA molecule to recognize more than one codon using its one anticodon sequence. It requires a shift in position of the two nucleotides. Guanine and uracil come together in this unusual pair via 2 hydrogen bonds. Based on what you know about hydrogen bond formation and base pairing, draw a guanine nucleotide and a uracil nucleotide hydrogen bound to one another.

Biology (MindTap Course List)

11th Edition

ISBN:9781337392938

Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Chapter13: Gene Expression

Section13.4: Translation

Problem 3C: A certain mRNA strand has the following nucleotide sequence: 5AUGACGUAUAACUUU3 What is the anticodon...

See similar textbooks

Similar questions

The sequence of a polypeptide is determined by the order of codons that specify the amino acids in the polypeptide. How many different sequences of codons can specify the polypeptide sequence methionine-histidine-lysine? (Use the table to find the number of possibilities.) SECOND BASE UAU UACFTyrosine (Tyr) UAA -Stop codon UAG -Stop codon UUUL UGU Cysteine (Cys) UCU uc UCA FSerine (Ser) uca Uuc Phenylalanine (Phe) UUAL Leucine (Leu) CAU CAC CAA Glutamine (Gin) CAGF UGA -Stop codon uaa -Tryptophan (Trp) CGU сос CGA FArginine (Arg) CU CU Histidine (His) CuA FLeucine (Leu) Cua) Proline (Pro) CCA cca AAU Asparagine (Asn) AGU Serine (Ser) AGC AUU ACU ACC Threonine (Thr) AACF AAA AAGLysine (Lys) AUC Fisoleucine (lle) AUA Methionine (Met) AUG - Start codon ACA ACG AGA AGGFArginine (Arg) GU GACAspartic acid (Asp) GGA GAA Glutamic acid (Glu) Gaa) GcU -Valine (Val) G GUA GCA FAlanine (Ala) Glycine (Gly) 8. 1 4 THIRD BASE 2. FIRST BASE
A series of tRNAs have the following anticodons. Consider the wobble rules listed in Table and give all possible codons with which each tRNA can pair. Q. 5′ –IAA–3′
Translate the following DNA sequence into a sequence of amino acids: TAC TAA GGA. The genetic code Second letter of codon UAU UUU Phenylalanine UCU UUC Phe) Tytosine (Tyr) UGU Cysteine (Cys) UGC UCC Serine (Ser) UCA UCG CCU UAC UA Stop codon UXG Stop codon 1oG Stop codon UGS Tryptophan (Trp) CGU CC UUA Leucine (Leu) UUG CAU Histidine (His) CAC CUC Leucine (Leu) CUA Proline (Pro) CA Arginine (Arg) CAR Glutamine (Gin) CGA CUG AUU AUC AUA CAG AAU AAC ACU Isoleucine (le) Asparagine (Asn) AGU Serine (Ser) ACC Threonine (Thr) ALA ARC GAU GAC ACA ACC GCO Methicnine: Lysine (Lys) AGA Arginine (Arg) AGS start codon GUU Aspartic acid (Asp)GGU GUC Valine (Val) GUA GCC Alanine (Ala) GO Glycine (Gly GCA GCG GAA Glutamic acid (Glu) GGA GUG GAG GGG methionine-isoleucine-proline. AUG AUU CCU UAC UAA GGA tyrosine-leucine-glycine First letter of codon Third letter of codon
Consider the following wild-type double-stranded DNA sequence: 5' TATGAA AGT3 non-transcribed strand (sense strand) 5' 3' ATACTTTCA transcribed strand In the space below, write ONE of the possible DNA sequences of the transcribed strand shown above that results from BOTH a single substitution mutation of the first codon following the start codon that would also cause a nonsense mutation. Use the mRNA codon chart in the Appendix of your manual to help you. Answer: Check
Use the codon chart to determine the following RNA strand in amino acids (Remember to write it the same way the strand is): ACA-AGG-UUA-UGA second letter C A UAU Tyr U UUU UCU UGU Phe Cys UUC UCC UAC UGC C Ser UAA stop | UGA stop| A UAG stop UGG Trp UUA UCA UUG Le UCG CUU CCU CAU CGU His CUC ССС CAC CGC Leu Pro Arg CUA ССА САА CGA Gln СCG CAG CGG CUG AGU AAU Asn AUU ACU Ser AGC S AGA Arg AAC AUC } lle A AUA АСC Thr AAA Lys АСА AUG Met ACG AAG AGG GUU GCU GAU GGU Asp GAC GGC Gly GGA GCC GUC Val Ala GAA GAG } GUA GCA Glu GGG GUG GCG Your answer first letter ACUCAGUCAGUCAG third letter
Consider the following 2 codons sequences. Codon sequence 1: ACU AGA GAU GUC UGC Codon sequence 2: GCG GAG AAA UGG UAU Draw an anti-parallel b-sheet that can be formed between the amino acids from the two codon sequences.
Which of the lettered arrows in the diagram of translation indicates an amino acid? A/G|G A AUGGG A C
What RNA base sequence is complimentary to the following DNA base sequence 5'-CATGATTAT-3'? Using the table of codons, give the primary structure of the protein coded for by the RNA sequence: 5’-CCA CGA GGG GAG ACU UAA-3’?
Given the following protein, which of the following sequences of TEMPLATE strand DNA would code for it? Pay attention to the polarity of the polypeptide and the strands of DNA that you choose. Use the codon chart to the right. AUG = met AAA = lys GCU = ala | CUU = leu ACU = thr -lys - thr - ala - leu - met (amino end) 5' TAC GAA CGA TGA TTT TAC ATT 3' 5' ATG CTT GCT ACT AAA ATG TAA 3' (carboxyl end) met 5' TAC TTT TGA CGA GAA TAC ATT 3¹' 3' TAC TTT TGA CGA GAA TAC ATT 5¹ 5' ATG AAA ACT GCT CTT ATG TAA 3¹ 3 TAC GAA CGA TGA TTT TAC ATT 5'
Part of a sequence of DNA from a person without this genetic disease is: TAG TAA AAA CCA CCC AGG Part of a sequence of DNA from a person with a genetic disease is: TAG TAA CCA CCC AGG The possible codons for some amino acids are shown in the table. Amino acid Codons glycine GGU GGC GGA GGG isoleucine AUU AUC phenylalanine UUU UUC serine UCU UCC UCA UCG Which amino acid is missing from a person with this genetic disease? serine glycine O phenylalanine isoleucine
Translate the following RNA sequence by using the genetic below. Start at the beginning of the sequence and don't worry about start and stop codons. Write out the sequence using the single letter code. (This table displays the amino acids in a single-letter code instead of a three-letter code. Each codon is found by matching the first position on the left of the chart, second position at the top, and last position at the right. For example, the codon CAG gives the amino acid "Q") 5' UCAACUGCGAAUCUGGAAUAU 3'
For the m-RNA nucleotide codons given below, what is the corresponding sequence of amino acids? AUG UGU AUA UAU GUA AUC ACC UUC UAU GUA ACA UUU UGG AAC AGC UGC CAU GUA UAC CAG AAA CUU GCA GAG CUG GCU UUG AUA UGA The α-helices are known to contain primarily the amino acids methionine, alanine, leucine, glutamate, and lysine, while β-pleated sheets are known to primarily contain the amino acids tryptophan, tyrosine, phenylalanine, isoleucine, valine, and threonine. Which one of these two types of secondary protein structure is present with this amino acid sequence?