Below is a double strand DNA sequence contain a gene and it will go under transcription, suppose that the 3/ → 5/ is the template strand: 3/-TAC-GAC-CGT-TGG-CTT-CTG-TGT-AGG-TAT-ACC-GAT-ACT-5/ 5-/ATG-CTG- GCA-ACC-GAA-GAC-ACA-TCC-ATA-TGG-CTA-TGA-3/ 1- Write down the mRNA transcript with direction of ends of the strand? 2- Construct the resulted polypeptide chain from translation of the mRNA above based on the following codons translation below AUG: Methionine GCA: Alanine ACC: Threonine UGA: write its name GAA: Glutamic acid GAC: Aspartic acid CUG: Leucine ACA: Threonine UCC: Serine AUA: Isoleucine UGG: Tryptophan CUA: Leucine

Q: The DNA sequence within the transcription unit of a gene is shown below. Important sequences are…

A: Transcription is the process which is responsible for making mRNA from the DNA by the action of RNA…

Q: A. The double-stranded DNA sequence for a bacteria is shown below and it's coding for a hypothetical…

A:

Q: 1. What is a codon? 2. For eaxh of the following mRNA codons, give the tRNA anticodon and determine…

A: Central dogma of cell comprises of two important processes. They are transcription of DNA into mRNA…

Q: Answer for 1 ,2,and 3  asap

A: Answer given in steps 2 onwards. Please find the attachment. Thank you

Q: Below is a double-stranded DNA: ATATGTGGTCTCGGTCCGTTAGGCAAT TATACACCAGAGCCAGGCAATCCGTTA   1. In…

A: The first step in gene expression is the synthesis of an RNA molecule copied from the segment of DNA…

Q: The beginning of the hexose kinase gene's sequence can be found below, the +1 nucleotide is…

A: Primer is short sequence which is complementary to the base sequence of DNA and is considered to be…

Q: The double-stranded DNA sequence for a bacteria is shown below and it's coding for a hypothetical…

A: The central dogma of life involves DNA replication, transcription, and translation into proteins.…

Q: The beginning of the hexose kinase gene's sequence can be found below, the +1 nucleotide is…

A: The ds DNA strand between position 20-30 3'- GATACGCGATG- 5' The sequence of primer that will be…

Q: Transcription. Using strand 1 of the DNA molecule as a template, transcribe a messenger RNA molecule…

A: Thank you for the question  Answer The Genes code for proteins. These proteins are the workhorse of…

Q: TAC CTA CTC TAG TTA ACCACA GTT GCCATC Transcribe the given template strand of DNA:I Second mRNA base…

A: The Genetic code is  :  1. Universal 2. Redundant 3.Non Ambiguous Genetic Codon have start and stop…

Q: A protein uses a gene template in 3' to 5' direction. What are the amino acid sequences following…

A: The protein is synthesized from mRNA by the process of translation. It takes place in cytoplasm of…

Q: Shown below is the " sense" strand of DNA. Second letter U What is the amino acid sequence that…

A: Introduction :- Deoxyribonucleic acid (DNA) is a molecule made up of two polynucleotide chains that…

Q: The diagram below shows a section of double-stranded DNA undergoing both transcription and…

A: DNA replication is the process in which the DNA copies are made by the action of several enzymes…

Q: The following is the base sequence of an exon portion of a template strand of a DNA molecule: 5'…

A: Introduction :- DNA acts the genetic material , present within the nucleus of a cell . It is a…

Q: Below is a template strand of DNA. Assume the transcription start site is outside of this sequence…

A: Transcription is the initial phase in gene expression, where data from a gene is utilized to develop…

Q: DNA is made of two strands that are antiparallel. If one strand runs from 3’ to 5’ direction the…

A: Deoxyribonucleic acid (DNA) is a biomolecule found in nearly all living organisms. The structure of…

Q: in m 5'- 3'- Shown below is a schematic diagram illustrating a very short gene with 3000 bp region…

A: Transcription is the process of formation of transcript that is mRNA from DNA. It is catalysed by…

Q: Silent Mutations in DNA – Notice one nucleotide pair differs from the normal sequence given in…

A: In silent mutations, a nucleotide change can contribute to no change in the phenotype, i.e., the…

Q: An enzyme is needed for the Krebs Cycle.  It will be made following the directions contained in a…

A: In eukaryotes, the genetic information needed for all cellular processes is encoded by genes, which…

Q: I’m supposed to translate tRNA into amino acids for each codon of the previous question and state…

A: Hi. After accepting the question, I see that you have incorrectly solved 2b and 2c. I am giving you…

Q: a. Below is a portion of a bacterial chromosome that contains a gene. The promoter region and the +1…

A: Transcription is a process in which a DNA strand is transcribed into mRNA by an RNA polymerase…

Q: Answer the ff. DNA fragment A is 3' AGC CCG CTC CGA GGC TAA AAG CGT 5' A. is the 3rd amino…

A: Transcription: The process of making mRNA from DNA is called Transcription. mRNA strand Synthesised…

Q: The beginning of the hexose kinase gene's sequence can be found below, the +1 nucleotide is…

A: Given:

Q: The transcription factor that unwinds DNA to expose the template strand Group of answer choices

A: The conversion of DNA's genetic information into mRNA takes place by a process known as…

Q: A template strand of DNA in a gene reads: ATGGCTGGGTGCTTTTAA. Using the codon chart provided, what…

A: The template DNA strand, from which the mRNA is synthesized is as follows, 5' ATGGCTGGGTGCTTTTAA3'…

Q: Give 7 examples where a specific nucleotide sequences/elements are recognized by protein or…

A: Replication is the process by which new strands of DNA are synthesized from pre-existing DNA.…

Q: sequence is 3 A DNA sequence before and after rep from left to right. The table below shows which…

A: DNA ( Deoxyribonucleic acid ) is a genetic material in most of organism . It is two stranded ,…

Q: Viruses that infect bacteria (bacteriophage) sometimes encode a lysozyme gene in their genome. The…

A: Bacteriophage is one type of virus which infects bacterial cell and destroy it. Bacteriophage…

Q: Bacteriophage T4 has a linear double-stranded DNA genome, yet mapping many mutations, as shown in…

A: T4 bacteriophage infects E.coli. It has a double stranded linear DNA genome. It undergoes a lytic…

Q: Consider the following segment of DNA, which is part of a linear chromosome: LEFT…

A: Answer. Transcription is a process of the formation of transcript (RNA). It takes place by the usual…

Q: A. The double-stranded DNA sequence for a bacteria is shown below and it's coding for a hypothetical…

A: Transcription is the process where mRNA will from form DNA, then mRNA will from protein in…

Q: The following sequence of DNA is part of the normal, wild-type gene.   5'TAC CGG GAC TTG AGC CGA…

A: A single nucleotide from the DNA is deleted in nucleotide deletion. Although the single nucleotide…

Q: Fill in the blanks.  In this schematic, [] represents a gene (DNA) that is transcribed and processed…

A: Transcription is a significant process that occurs in a cell through which the RNA is synthesized…

Q: Write a paragraph about transcription, and include the following terms: transcription factors,…

A: Transcription is a process in which RNA molecule is produced from the DNA template strand or non…

Q: Matching Match each item with the correct statement below. Not all terms will be used a. 5' GTP cap…

A: Introduction Gene expression is the process through which information from a gene is utilised in the…

Q: Choose your choice of 5 amino acids Don't forget - the start code and the stop code Put them in the…

A: Proteins are made up of a set of 20 amino acids called standard amino acids. A three-letter code of…

Q: THE MOLECULAR GENETICS OF CYSTIC FIBROSIS The following is the base sequence of DNA that codes for…

A: Introduction  One strand of DNA holds the information that codes for various genes. This strand is…

Q: Mutation #2: • Change the Mutation to RED TACACC IIGGCGACGACT AUGUGG A ACCG CU G CUGA MET -TRP- ASN…

A: Original DNA sequence TAC ACC TTG GCG ACG ACT mRNA sequence           AUG UGG AAC CGC UGC UGAAmino…

Q: 5. A DNA sequence of "ACG" will code for the amino acid (LS1- 1) * Second mRNA base U UUU Phe UCU…

A: Each codon in mRNA is made up of three nucleotides, and each codon indicates a certain amino acid…

Q: Consider the following DNA strand with the following nucleotide sequence: 3’-ATATCAGAGAATATCA-5’…

A:

Q: The following is the base sequence of DNA that codes for amino acids 506-510 of the protein that…

A: Since we only answer up to 3 sub-parts, we’ll answer the first 3. Please resubmit the question and…

Q: Only answer please, no need to explain… Thank you for your time. i:  Modification of the 5 prime…

A: Answers :  i) capping    ii) all of these    iii) transcription

Q: Shown is a segment of DNA with its promoter and terminator. Start and end of transcription are…

A: Transcription is the phenomenon in which one stranded RNA is synthesized from DNA strand . But RNA…

Q: 2. Muscular dystrophy is a genetic disorder that causes progressive muscle weakness as individual…

A: Mutations are the change in the DNA sequence that it leads to several disorders. mutations can be a…

Q: ads 5' to 3' right to left. The nucleotides are numbered 1 to 100. REMINDER: For thi oblem,…

A: The central dogma of molecular biology is a metabolic process of cell where one strand of the double…

Q: mutation each as Deletion, Insertion or Substitution AND as either , missense, silent or nonsense…

A: In this question, we have to identify the type of mutation in the given DNA sequence.

Q: 1. Which of the following enzymes can polymerize deoxyribonucleotides into DNA? A) Primase B) DNA…

A: There are different biomolecules present, and they include nucleic acids, proteins, lipids,…

Q: Transcribe the corresponding mRNA strand from the given DNA strand:    DNA:     TAC       GCA…

A: BASIC INFORMATION DNA It stands for deoxyribo nucleic acid.  It is the genetic material of all…

Q: DNA message #4: AAA-CTT-CGC-TGG-GTG-CTC-TCC-AAC-CTT-TCA-TCG Transcription to mRNA: UUU GAA GCG ACC…

A: The proteins are formed from the mRNA which is formed from the DNA by the process of Transcription,…

Q: Consider the following segment of DNA, which is part of a linear chromosome: LEFT…

A: RNA transcription is a process where double-stranded DNA is transcribed into mRNA. This mRNA is…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.