Below is a diagram oT a gene that is not normally alternatively spliced. All Tour exons (represented as boxes) are found in the mature MRNA. Transcription starts at the arro labeled TSS, transcription stops at the line labeled TT, and the promoter location is indicated by the line. The indicated DNA sequences for two individuals are found within exon 2 as indicated, with Individual 2 having a mutation. Both sequences are in-frame with the upstream start codon. ATG ТАА Promoter (Start codon) (Stop codon) TSS TT Individual 1 5' ACAGGAGGAATAAGTTATGCA 3' Individual 2 5' ACAGGAGGAATAAGTTAAGCA 3 Part 1 You isolate the mature mRNAs for each individual and run them on a northern blot. Compared with the mRNA for Individual 1, you find that the mRNA for Individual 2 is more abundant. the same length. shorter. alternatively spliced. o000

Below is a diagram oT a gene that is not normally alternatively spliced. All Tour exons (represented as boxes) are found in the mature MRNA. Transcription starts at the arro labeled TSS, transcription stops at the line labeled TT, and the promoter location is indicated by the line. The indicated DNA sequences for two individuals are found within exon 2 as indicated, with Individual 2 having a mutation. Both sequences are in-frame with the upstream start codon. ATG ТАА Promoter (Start codon) (Stop codon) TSS TT Individual 1 5' ACAGGAGGAATAAGTTATGCA 3' Individual 2 5' ACAGGAGGAATAAGTTAAGCA 3 Part 1 You isolate the mature mRNAs for each individual and run them on a northern blot. Compared with the mRNA for Individual 1, you find that the mRNA for Individual 2 is more abundant. the same length. shorter. alternatively spliced. o000

Name: 15 Below is a diagram of a gene that is not normally alternatively spl
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: 15 Below is a diagram of a gene that is not normally alternatively spliced. All four exons (represented as boxes) are found in the mature mRNA. Transcription starts at the arrowlabeled TSS, transcription stops at the line labeled TT, and the promoter

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 10QP: The pre-mRNA transcript and protein made by several mutant genes were examined. The results are...

See similar textbooks

Similar questions

The following four mutations have been discovered in a gene that has more than 60 exons and encodes a very large protein of 2532 amino acids. Indicate which mutation would likely cause a detectable change in the size of the mRNA and/or the size of the protein product. Consider a detectable change to be >10% of the wild-type size. A table of the genetic code is shown below. First letter 0 00 U O A บบบ UUC UUA UUG U CUU CUC CUA CUG Phe GUU GUC GUA GUG Leu >Leu AUU AUC lle AUA AUG Met >Val UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG Second letter C Ser Pro Thr Ala CAU CAC CAA CAG UAU UGU Tyr UAC UGC UAA Stop UGA UAG Stop UGG AAU AAC AAA AAG A GAU GAC GAA GAG His Gin Asn Lys Asp G Glu CGU CGC CGA CGGJ AGU AGC AGA AGG GGU GGC GGA GGG O AAG576UAG (changes codon 576 from AAG to UAG) Cys Stop Trp O GUG326AUG (changes codon 326 from GUG to AUG) Arg Ser Arg Gly DUAG DUA G DCAG DO AG deletion of codon 779 insertion of 1000 base pairs into the sixth intron (this particular…
c) A gene in a bacteria has the following DNA sequences (the promoter sequence is positioned to the left but is not shown): 5'-CAATCATGGAATGCCATGCTTCATATGAATAGTTGACAT-3' 3'-GTTAGTACCT TACGGTACGAAGTATACTTATCAACTGTA-5' i) By referring to the codon table below, write the corresponding mRNA transcript and polypeptide translated from this DNA strand. 2 Second letter с A UUUPhe UAU Tyr UAC. UGU UGCJ UCU) UCC UCA UUG Leu UCG Cys UUC UUA Ser UAA Stop UGA Stop A UAG Stop UGG Trp G CUU CÚC CCU ССС CAU CGU His САC Pro CC CỦA Leu ССА CAA Arg CGA CUG J CCG) CAG Gin CGG AUU ACU AAU Asn AGU Ser AUC le АСC АCА AAC AAA AGC. Thr JArg AUA AGA AUG Met ACG AAG Lys AGG. GAU Asp GUU) GCU GCC GCA GCG GGU" GGC GGA GGG GUC Val GUA GAC Ala Gly GAA Glu GAGJ GUG ii) If the nucleotide indicated by the highlighted bold letter undergoes a mutation that resulted in deletion of the C:G base pair, what will be the resulting amino acid sequence following transcription and translation? Third letter DUAG DUAG DUAG A. First…
The following double-stranded DNA sequence is part of a hypothetical yeast genome which contains a very small gene. Transcription starts at the Transcription Start Site (TSS), proceeds in the direction of the arrow and stops at the end of the Transcription Terminator (green box). 5' 3' TSS CTATAAAAATGCCATGCATTATCTAGATAGTAGGCTCTGAGAAATTTATCTCACT | | | | | | | | | | GATATTTTTACGGTACGTAATAGATCTATCATCCGAGACTCTTTAAATAGAGTGA - 5' PROMOTER TERMINATOR 3' a) Which strand (top or bottom) is the template strand? Explain why. b) What is the sequence of the mRNA produced from this gene? Label the 5' and 3' ends. c) What is the sequence of the protein produced from the mRNA? d) If a mutation (an insertion) were found where a T/A (top/bottom) base pair were added immediately after the T/A base pair shown in red, what would be the sequence of the mRNA? What would be the sequence of the protein?
Shown below are different regions of an eukaryotic gene. Which of the above regions of a gene will be transcribed? Or which regions will be part of the new RNA molecule that is synthesized during transcription? Select all that apply. Promoter Intron Exon Transcription stop sile Transcription start site 5- 31 ATG 75 TAC TAA ATT 3' 5' 50 100 300 200 228 50 3' 5' Start Splice donor codon Splice аcсeptor Splice acceptor Splice donor Stop codon Exons Ribosomal binding site Promoter Introns
A eukaryotic protein-encoding gene contains two introns and three exons: exon 1–intron 1–exon 2–intron 2–exon 3. The 5′ splice site at the boundary between exon 2 and intron 2 has been eliminated by a small deletion in the gene. Describe how the pre-mRNA encoded by this mutant gene will be spliced. Indicate which introns and exons will be found in the mRNA after splicing occurs.
The following is a DNA sequence of gene Z. The underlined sequence represents the promoter for gene Z and the underlined and italicized sequence encodes the gene Z ribosome binding (RBS) site. Transcription begins at and includes the T/A base pair at position 60 (bold) a. What are the nucleotides of the mRNA from gene Z?b. What are the amino acids encoded by gene Z? (A codon chart is found on the finalpage)
Draw the SMN2 pre-mRNA (10 exons and 9 introns), indicate the 5’ and 3’ SS location. Draw the SMN2 mature mRNA before treatment with Spinraza. What type of alternative splicing is occurring? Draw the SMN2 mature mRNA after treatment with Spinraza
Help me please
Below is the double stranded DNA sequence of part of a hypothetical yeast genome encoding a very small gene. Transcription starts at nucleotide immediately following the promoter. The termination sequence is TATCTC. How many amino acids will this protein have? 5' TCATGAGATA GCCATGCACTA AGGCATCTGA GTTTATATCT CA 3' 3' AGTACTCTAT CGGTACGTGAT TCCGTAGACT CAAATATAGA GT 5'
"Upstream" "Downstream" Exons Start of transcription Termination codon 5 3' Promoter initiator codon Introns Polyadenylation signal (intervening sequences) 5' untranslated region 3' untranslated region Direction of transcription Please study the diagram above on eukaryotic gene expression. In order to provide instructions for gene expression, a eukaryotic gene should have the following sequences except for O A. Promoter B. Start codon also known as initiator codon C. Splicing signals (dinucleotide sequence in the intron) O D. 5' CAP sequence
a) What is a mutation in molecular terms? b) a mutation deletes a base in the genomic DNA discuss how that will affect the reading frame and expression product production. Using the following list of codons describe, using diagrams etc., how information stored in the DNA is translated into a peptide. Be sure to discuss all steps. In other words, use a diagram and give me sequences, transcription and translation steps. Show the sequences of the sense and the other DNA strand, the mRNA and the tRNA’s. UUU -phenylalanine UCU -serine AUG –initiation/methionine CUU -leucine ACU -threonine GUU -valine UAA -Termination
Consider this list (below) of steps involved in transcription. These steps are out of order. TRANSCRIPTION: 1. mRNA travels through a nuclear pore and enters the cytoplasm 2. the mRNA polymerase attaches at the start of a specific gene 3. RNA polymerase reads the gene surface4. a transcription factor bonds to a promoter site5. DNA molecule is unwound 6. a complimentary mRNA is produced What is the correct order of this transcription?