pls do the data 1. As a scientist in Company X, your manager asks you to design a methodology toseparate the three DNA sequences: DNA1 (ATTAAT), DNA2 (ATGCAT) and DNA3(GCCGCC). Then draw the expected data shown by the method.

DNA or deoxyribonucleic acid is the genetic material that contains information that is passed from…

Answered: As a scientist in Company X, your…

Concepts of Biology

1st Edition

ISBN:9781938168116

Author:Samantha Fowler, Rebecca Roush, James Wise

Publisher:Samantha Fowler, Rebecca Roush, James Wise

Chapter10: Biotechnology

Section: Chapter Questions

Problem 7RQ: What is the most challenging issue facing genome sequencing? a. the inability to develop fast and...

See similar textbooks

Similar questions

How would you solve this and how would it look? i am confused
For what purposes is DNA extraction done? (give at least 3 purposes for which you may need to extract DNA)
Which of the following best describes the process of DNA seqencing. a. DNA is seperated on a gel and the different bands are labled with flouroscent nucleotides and scanned with a laser. b. A laser is used to flurorescently label the nucleotides present with in the DNA , the DNA is run on a gel and then the DNA is droken into fragments c. Nucleotides are scanned with a laser and incrprorated into the DNA that has been seperated on a gel and then DNA is amplified with PCR. d. fragments of DNA are produced in a reaction that lables them with any of four different fluroscent dyes and the fragmented then are run on a gel and scanned with laser e. DNA is broken down into its constituents nucleotides and the nucleotides are then run on a gel and purified with a laser
1. Why do we need to check the isolated DNA for its quantity and quality? 2. The purity of DNA sample is below 1.8 A260/A280 so, where did the proteincontamination come from? Note: Cite the in-text citation and references
A piece of DNA fragment is sequenced. You clone the the fragment, isolate the cloned DNA fragment, and set up a series of four dideoxy reaction. You then separate the products of the reaction by gel electrophoresis and obtain the following banding patter: ddATP ddTTP ddCTP ddGTP What is the base sequence of the original fragment that you were given? 5'-TAAGCTGA-3' O 5'-ATTCGACT-3' O 5'-TCAGCTTA-3' O 5'-AGTCGAAT-3'
Place the steps in the photo in order during DNA extraction.
2) A scientist wants to increase the amount of sample of a DNA sequence of 100 bps. Calculate the number cycles of PCR required to generate 1 ng of DNA, when starting from a single copy. Note that the molar mass of an average DNA bp is 600 g/mol.
Explain why we choose to use 1% agarose gel for Electrophoretic Analysis of DNA via Agarose gel Electrophoresis
1. Determine the chemical reagents utilized in banana DNA extraction and their roles. What role does each reagent play to isolate DNA? Note:Materials:1. ripe banana 2. distilled water 3. liquid dishwashing soap 4. table salt 5. isopropyl/ethyl alcohol 6. fork7. plastic cups8. tape 9. plastic spoons10. measuring spoons and a measuring cup 11. cone paper coffee filter 12. plastic drinking glass
After properly troubleshooting, you finally are able to visualize the gel. You obtained the image below. The ladder used is “Lambda Hind III”. 1. Looking at the gel results, what can you say about the quality of DNA extraction for protocols 1, 2 & 3? 2. What would you take into consideration when selecting a molecular marker or leader to include in your gel run?
How would you approach this problem? You plan to sequence the following DNA by Sanger sequencing. Your reaction includes your sequencing primer (5' is on the left) and template DNA (5' end is on the left), dNTPs, buffer, DNA polymerase and the following fluorescent ddNTPs: red ddGTP, green ddATP and blue ddTTP. Sequencing Primer: CCGCCGGGCCCCAT Template to be Sequenced: GAGCGGCGGGCTGAGTAGCTCGCCGCGGGGATGGGGCCCGGCGGATT
How would you solve this question? I am confused

SEE MORE QUESTIONS

Recommended textbooks for you

Concepts of Biology

Biology

ISBN:

9781938168116

Author:

Samantha Fowler, Rebecca Roush, James Wise

Publisher:

OpenStax College

Biology: The Dynamic Science (MindTap Course List)

Biology

ISBN:

9781305389892

Author:

Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:

Cengage Learning

Human Heredity: Principles and Issues (MindTap Co…

Biology

ISBN:

9781305251052

Author:

Michael Cummings

Publisher:

Cengage Learning

Concepts of Biology

Biology

ISBN:

9781938168116

Author:

Samantha Fowler, Rebecca Roush, James Wise

Publisher:

OpenStax College

Biology: The Dynamic Science (MindTap Course List)

Biology

ISBN:

9781305389892

Author:

Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:

Cengage Learning

Human Heredity: Principles and Issues (MindTap Co…

Biology

ISBN:

9781305251052

Author:

Michael Cummings

Publisher:

Cengage Learning

SEE MORE TEXTBOOKS

As a scientist in Company X, your manager asks you to design a methodology to separate the three DNA sequences: DNA1 (ATTAAT), DNA2 (ATGCAT) and DNA3 (GCCGCC). Then draw the expected data shown by the method.