An 800 bp fragment is completely digested with a single restriction enzyme. Fragments of 50*, 150*, 200, and 400 bp are found. (Asterisks denote radioactively labeled end pieces.) Which order is consistent with the results? Group of answer choices 150, 200, 50, 400 150, 400, 50, 200 150, 200, 400, 50 400, 150, 50, 200

Q: The following is the base sequence of DNA that codes for amino acids 506-510 of the protein that…

A: Introduction  Deoxyribonucleic acid is a polymer made of two polynucleotide chains that coil around…

Q: digest suspect B's DNA using restriction enzyme 1. Restriction enzyme 1 cleaves the recognition site…

A: The restriction enzymes are endonucleases that digest DNA (deoxyribonucleic acid) molecules by…

Q: A next-generation method of DNA sequencing, 454 sequencing, uses pyrosequencing in which the…

A: Pyrosequencing is a next-generation technique of DNA sequencing. This method can be used to detect…

Q: You have a DNA sequence of 1800 bp. To characterize it, you decide to make a restriction map.…

A: Restriction mapping is a process that helps to determine the location of the restriction site. The…

Q: Sickle cell anaemia is caused by a mutation in the HBB gene. The normal wild-type βA allele contains…

A: Sickle cell anemia is a result of a mutation in the HBB gene. This gene contains the restriction…

Q: A colleague of yours is studying a genetic disease and trying to determine its location on a…

A: Gene is the sequence of nucleotide that encodes a particular protein.

Q: A cloned fragment of DNA was sequenced by using the dideoxy method. A part of the autoradiogram of…

A: Sanger sequencing, often called chain-termination sequencing, is a DNA sequencing technology…

Q: How would you solve this question? I am confused

A: The objective of this question is to estimate the size of an unknown DNA fragment using a standard…

Q: The right-hand column contains descriptions of 5 types of molecular markers. Label each description…

A: These markers are pivotal tools within the field of genetics and genomics, helping researchers…

Q: A researcher wants to cut this piece of linear DNA. 5 AGCTAGTCCGGATCCGAGGGCCCTTCTCATGAGATCCGGATGACC…

A: The discovery of restriction enzymes in 1968 by Swiss scientist "Werner Arber" ushered in the era of…

Q: A fragment of DNA that was cut with a restriction enzyme has a 3’ overhang. This overhang is…

A: Restriction Enzymes: These enzymes identify certain DNA sequences, known as recognition or…

Q: Use the gel to answer the following questions. You will be constructing a map of the plasmid,…

A: Plasmids have been used in genetic engineering for cloning and expression. These carry the genes for…

Q: gment shows where a number c between those cut sites in base Bem het Bem H 700 800 1000 1100

A: A restriction enzyme, also known as a restriction endonuclease or restrictase, is an enzyme that…

Q: You have 15 tubes, each containing 5 ul of DNA (each tube has a different DNA to cut). You want to…

A: A reaction mixture is a combination of 2 or more reactants in definite proportions to carry out a…

Q: You digest a piece of DNA that is 98 000 base pairs long, with a restriction endonuclease having a…

A: The objective of this question is to determine the number of fragments that would be produced when a…

Q: Choose the combination of answers that most accurately completes the statement.Which of the…

A: Restriction endonuclease or restriction enzyme is a type of enzyme used in cloning studies. It is…

Q: 3000 bp 2000 bp 1000 bp 800 bp 700 bp 500 bp L Uncut EcoRI 1 BamHI Ncol EcoR1/BamH1 BamHI/Nco1…

A: Use the gel to answer the following questions. You will be constructing a map of the plasmid,…

Q: A 3000 bp circular DNA was treated with both HindIII and EcoRI restriction enzymes. EcoRI cuts at…

A: In this question, we are given two restriction enzymes EcoRI and HindIII with their restricting…

Q: Give the interpretation of the given images

A: Gel electrophoresis is a widely used laboratory technique for separating and analyzing DNA, RNA, or…

Q: Tell me how did you prepared the gel if the tray is 150 ml? how many milliliters of the TBE and how…

A: The answer to the first question is, 3 grams of agarose in 150 ml of TBE.   *to get the second…

Q: A student wanted to load .75 ug dna on agarose gel and has 4x loading buffer for sample preparation.…

A: Agarose gel electrophoresis is a method used for the separation of DNA fragments which is stained by…

Q: Which of the following will lead to DNA cutting more frequently? Choose all that apply.

A: The restriction enzymes are enzymes that cut the DNA at specific nucleotide sequences called the…

Q: The diagram (below) shows the completed gel of a Sanger sequencing reaction. The arrows at the…

A: gel electrophoresis is a process in which the negatively charged DNA molecule is separated according…

Q: A purified piece of DNA of 1650bp is cut with Hind III and Pst I separately and then with both…

A: Restriction enzymes are endonucleases derived from bacteria that make a double-stranded cut in the…

Q: Circle the section on the DNA template where the example primer would bind.

A: A primer binds to a specific region of a single-stranded DNA template, known as the primer binding…

Q: Use the gel to answer the following questions. You will be constructing a map of the plasmid,…

A: Plasmids are circular double-stranded DNA elements. These are found in prokaryotes. The plasmids…

Q: Name the bacterial enzyme that takes over new strand synthesis in replication after the primer is…

A: The process in which the genetic material of an organism (DNA in this case) is duplicated is called…

Q: You want to insert a sequence in the lacI gene to alter its function,what restriction enzyme(s) will…

A: The lacI gene is a part of the lac operon, that codes for a protein that inhibits the expression of…

Q: Which of the following are necessary for Sanger sequencing? Select all correct answers. Group of…

A: Sanger sequencing method  was developed by the Frederick Sanger and his colleagues in 1977.This…

Q: The following picture shows the ethidium bromide-stained bands obtained by gel electrophoresis of…

A: Electrophoresis is a molecular technique that employs the electrical field to assort biomolecules,…

Q: A. The team compares the sequence of the gene from the patient with three other patients the team…

A: Point mutations are changes in a single nucleotide base pair of DNA. There are three types of point…

Q: The human gene for hemophilia is on the X chromosome. Below is a pedigree from a family afflicted…

A: Hi, Thanks For Your Question.  Answer : Correct Option Is b (20%) Explanation :  P (III-7 Is…

Q: If this gene is methylated, which of the following combinations of DNA fragments would you expect…

A: Answer: RESTRICTION ENZYME = It is the enzyme which cuts the strands of DNA at specific sites…

Q: Write the sequences of the two 12-residue primers that could be used to amplify the following DNA…

A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…

Q: Tailed primer can have restriction enzyme sites. True False

A:

Q: Based on the image below, answer the following questions:   Restriction enzymes PstI and ScaI were…

A: Restriction enzymes  These enzymes have the capability to identify and cleave specific restriction…

Q: constructing a map of the plasmid, pDiddy.   What is the smallest fragment size that the…

A: Double digestion Restriction enzymes are eye enzymes that induce cuts(cleavage) at their specific…

Q: Which of the following components are required for the polymerase chain reaction (PCR)? Select all…

A: The components that are required for PCR are-  dNTPs, DNA polymerase, Oligonucleotide primers