a. what is the non-template/sense/coding strand?

Q: Base on the coding strand of DNA: ATG GGA ATT CGC What is the sequence of the complementary…

A: DNA or DeoxyRiboNucleic Acid is a biomolecule which serves as a genetic material in number of…

Q: What is the mRNA coded by this template DNA strand? DNA Template Strand: 3' ATGGTACGGTCG 5'…

A: A codon is known to code by three different types of bases in a particular mRNA. Hence, a codon is…

Q: One strand of a double-helical DNA has the sequence 5'-GCGCAATATTTCTCAAAATATTGCGC-3'. Write the base…

A: DNA stands for deoxyribonucleic acid and is found in the nucleus of eukaryotic cells and in the…

Q: E D A 11. Ligase is denoted by letter 12. The Okazaki fragment is denoted by letter . 13. The SSB…

A: DNA (Deoxyribonucleic acid) and RNA are two examples of nucleic acids (Ribonucleic acid).…

Q: How many hydrogen bonds exist between this DNA strand and its complementary strand? I and…

A: In the 1950s, Erwin Chargaff, a biochemist, discovered that the nitrogenous bases (A, T, C, and G)…

Q: 14.11) Fill in the missing one-letter abbreviations for the organic bases in the image below to show…

A: DNA stands for Deoxyribonucleic Acid. It is a molecule that contains the genetic instructions used…

Q: A 5' 3' 3' 5' 12. Using the image above, match the red letters with the following: leading strand,…

A: The given image is the replica of the 'Replication fork' , part of the DNA which go through the…

Q: What is the RNA transcript that would result from the double stranded DNA segment shown below?…

A: Gene expression is mostly dependent on the transcription process, which creates RNA from a DNA…

Q: ou are given a segment of DNA : 5’  - CATGTCAAC – 3’    What is the complimentary strand?

A: Adenine in DNA always pairs with Thymine and cytosine always pairs with Guanine and vice versa .…

Q: If a virus particle contained double-stranded B-DNA of 400,000 base pairs, A. What would be the…

A: DNA, deoxyribonucleic acid is the hereditary material in found in humans and almost all living…

Q: The DNA sequence you use will be the following:  T - A - G - C - C - A.  You will need to make the…

A: chargaff's rule states that in DNA sequence in  complementary strands the Adenine will form a bond…

Q: How do I translate the DNA sequence below: 5'-ATGGCCTGGCATTCA-3' 3'-TACCGGACCGTAAGT-5'

A: DNA stands for Deoxyribonucleic acid. It is a molecule composed of two polynucleotide chains to form…

Q: (iij If one of the strands of DNA has the following sequence of bases running in the 5'3' direction…

A:

Q: 5'- What will be the Sanger products of the DNA with base sequence ACGTCGACTCCGGTC-3'

A: DNA sequencing is the biochemical method used for determining the order of nucleotide bases, A, G,…

Q: 1 a)The nucleotide sequence below is one half of a double stranded DNA sequence. The highlighted…

A: Since you have asked multiple questions, we will solve the first question for you. If you want any…

Q: You will start off by laying out your individual nucleotides for the first strand using the…

A: DNA is a macro molecule or a polymer which is made up of a monomer called nucleotides. Each…

Q: One strand of a double-helical DNA has the sequence 5'-GCGCAATATTTCTCAAAATATTGCGC-3'. Write the base…

A: Introduction DNA is the molecular structure that is composed of a pair of polynucleotide chains…

Q: 2. Refer to the protein phe-trp-tyr-cys-ala-met-leu, construct a DNA strand that can transcript an…

A: mRNA stands for messenger RNA which is a single stranded RNA molecule that is complementary to one…

Q: One DNA strand has the sequence  5' -ATTCCGTAGC-3' what is the complementary strand sequence?

A: DNA ( Deoxyribonucleic acid ) is two stranded structure which act as genetic material in most of the…

Q: 7 Which of the following is the correct polypeptide chain for the mRNA strand shown below?…

A: A codon is a group of three nucleotides in an mRNA grouped to code for a particular amino acid. The…

Q: 5-ccuaaucg-34 3'-acctgcctataccggattagetetgatectaagcatgte-5" The diagram above shows an RNA primer…

A: Given -  RNA primer :   B   5'-ccuaaucg-3"    C   Template strand :    A…

Q: 5’ TAAGCGTAACCCGCTAA   CGTATGCGAAC   GGGTCCTATTAACGCAC 3’ 3’ ATTCGCATTGGGCGATT   GCATACGCTTG…

A: The DNA is a double stranded molecule which are paired along with a complimentary strand. The above…

Q: The sequence below shows one strand of DNA. Parts of the sequence are in capital letters to help you…

A: Since you have posted a question with multiple sub-parts, we will solve first three sub-parts for…

Q: 5'- ATG CTG TTT GTA CGG GÁC TAA-3' a) Write out the DNA template side for the DNA coding side above?…

A: Introduction The term template strand refers to the sequence of DNA that is copied during the…

Q: 48 Second letter If any single nucleotide is deleted from the DNA sequence shown below, what type of…

A: The antisense DNA sequence is - 5' GGACCCTAT 3' The single nucleotide deletion can occur at any…

Q: sing the genetic code provided what would be the corresponding polypeptide sequence for the DNA…

A: The DNA is transcribed into the RNA by the process of transcription and the RNA is translated into…

Q: 1. What would be the amino acid sequence encoded by the MRNA 5'CCAUGACGUCGGAUCAAUGAGC 3' 2. If the…

A: DNA replication is the process in whichbbhvgvhghhccvfgcbgvh

Q: What is the sequence of amino acids from this piece of DNA? 3' CGTACCGGCGGCGGATTA 5'

A: Central dogma is heterocatalytic poses, in which DNA is transcribed into mRNA, and then mRNA is…

Q: What is the nucleotide sequence of the complementary strand of the DNA molecule:…

A: Nucleic acids are large macromolecules that store hereditary information for cellular growth and…

Q: Draw the following structure. 1)A single strand of DNA with the sequence 5' GCAT 3'

A: Sure, here's a simple representation of a single strand of DNA with the sequence 5' GCAT 3':   5'  G…

Q: Shown below is the antisense strand of DNA. What is the amino acid sequence that corresponds to this…

A: A codon is a three-nucleotide sequence of DNA or RNA that corresponds to a specific amino acid or…

Q: Which well(A through E) of this agarose gel contains the smallest DNA size? Please look at the pic.

A: Gel electrophoresis technique of separation of molecules on the basis of their size and charged…

Q: The single strand of DNA below forms a hairpin structure with a loop that is 5 nucleotides long. 5'…

A: Hydrogen bonds between nucleotides that are complementary in the loop and stem regions help to…

Q: I need help because i don't get it. Can you help me to explain to me, please?

A: DNA It refers to the molecule that constitutes genetic information that is passed from generation ot…

Q: Using the following coding DNA sequence:TAC GCA CCT TTA GAT CAT AAC TTT GGA ACT1. Write the…

A: Deoxyribose nucleic acid (DNA) is the genetic material composed of four nucleotide bases, namely…

Q: What is the Complimentary DNA Strand to CGTCAGCAGACGAAAGGGCTTGCGGCGCGC. What is the content of CG in…

A: To find the complementary DNA (cDNA) strand, we need to identify the base pairs for each nucleotide…

Q: ENE 2: Nose Style DNA Template Strand ATG- GGG- CTT- CTC- TTT MRNA tRNA Amino Acids APPEARANCE

A: Above table is codon anti-codon table for translation of DNA code into protein sequence.

Q: Protein synthesis is a complicated process involving DNA being transcribed to RNA, which is then…

A: Protein synthesis is a complicated process involving DNA being transcribed to RNA, which is then…

Q: ’ GGACCTATCAAAATCCTTAATGCGCTAGGATAGCTAACGCATCCAC3’ Fill in the complimentary DNA strand and…

A: Watson and Crick elucidated in 1953 , the famous double stranded structure of the DNA molecule and…

Q: 3’-T A C G G A C T G A C G A T C-5’ What is its Complementary DNA sequence? mRNA sequence…

A: The term mutation refers to the change of DNA sequence which occurs either due to errors in DNA…

Q: Yhich amino acid is considered to be hydrophilic? a. Methionine b. Alanine c. Glycine d. Threonine

A: Hydrophilic amino acids are those acids which are highly stable when present in water. They are…

Q: 36/ In the figure representing DNA replication represents the leading strand? AA C.C DD None of the…

A: DNA replication means making a replica or copy of the DNA strands. DNA is a double-stranded…

Q: What is the conformation of the glycosidic bond (i.e. orientation of the nucleobase relative to the…

A: All living organisms are made up of cells, which are the most basic unit of life. They are…

Dissection

Dissection is the process of cutting up the tissue of a dead or live animal or plant, to do anatomical studies and surgical treatments. The purpose of dissection is to learn more about the overall structure of organs and organ systems and thereby understand the physiology of the organism.