a. what is the non-template/sense/coding strand?

Q: This is the original strand of DNA: ATG AAG TTT GGC TAA - what would represent a frameshift mutation…

A: A mutation refers to any alteration in the sequence of DNA (deoxyribonucleic acid) due to some…

Q: Answer the following:  DNA fragment A is 3' AGC CCG CTC CGA GGC TAA AAG CGT 5' 1. is % of guanine…

A: The central dogma of life is that DNA self replicates to form its own copies. The copied DNA is…

Q: Create the complimentary strand for the DNA strand below. Make sure to label the parts and…

A: DNA molecules store genetic material and two primary processes are necessary in order for DNA to…

Q: What is the mRNA coded by this template DNA strand? DNA Template Strand: 3' ATGGTACGGTCG 5'…

A: A codon is known to code by three different types of bases in a particular mRNA. Hence, a codon is…

Q: One strand of a double-helical DNA has the sequence 5'-GCGCAATATTTCTCAAAATATTGCGC-3'. Write the base…

A: DNA stands for deoxyribonucleic acid and is found in the nucleus of eukaryotic cells and in the…

Q: E D A 11. Ligase is denoted by letter 12. The Okazaki fragment is denoted by letter . 13. The SSB…

A: DNA (Deoxyribonucleic acid) and RNA are two examples of nucleic acids (Ribonucleic acid).…

Q: Take each of the DNA sequences and complete ALL of the following steps: i. Find the DNA Replication…

A: A set of guidelines known as the genetic code controls how genetic information is converted from DNA…

Q: A 5' 3' 3' 5' 12. Using the image above, match the red letters with the following: leading strand,…

A: The given image is the replica of the 'Replication fork' , part of the DNA which go through the…

Q: What is the RNA transcript that would result from the double stranded DNA segment shown below?…

A: Gene expression is mostly dependent on the transcription process, which creates RNA from a DNA…

Q: If a virus particle contained double-stranded B-DNA of 400,000 base pairs, A. What would be the…

A: DNA, deoxyribonucleic acid is the hereditary material in found in humans and almost all living…

Q: 4. The template strand from the previous question is mutated to the DNA sequence shown below: 3' GTC…

A: transcription is the process by which messenger rna is made from dna .

Q: Give the DNA compliment to the following DNA strand. GTA SMH UUU GUA CAT

A: In DNA replication, the rule of complementarity is as follows- 1. Adenine (A) and Thymine (T) are…

Q: (iij If one of the strands of DNA has the following sequence of bases running in the 5'3' direction…

A:

Q: 1 a)The nucleotide sequence below is one half of a double stranded DNA sequence. The highlighted…

A: Since you have asked multiple questions, we will solve the first question for you. If you want any…

Q: You will start off by laying out your individual nucleotides for the first strand using the…

A: DNA is a macro molecule or a polymer which is made up of a monomer called nucleotides. Each…

Q: The following is a section of DNA removed from a cell nucleus: 5'…

A: The basic physical and functional unit of heredity is the gene. DNA is the material that makes up…

Q: A nucleotide sequence in a segment of a DNA information strand is given here. Sketch (A) the…

A:

Q: 5-ccuaaucg-34 3'-acctgcctataccggattagetetgatectaagcatgte-5" The diagram above shows an RNA primer…

A: Given -  RNA primer :   B   5'-ccuaaucg-3"    C   Template strand :    A…

Q: 48 Second letter If any single nucleotide is deleted from the DNA sequence shown below, what type of…

A: The antisense DNA sequence is - 5' GGACCCTAT 3' The single nucleotide deletion can occur at any…

Q: 1. What would be the amino acid sequence encoded by the MRNA 5'CCAUGACGUCGGAUCAAUGAGC 3' 2. If the…

A: DNA replication is the process in whichbbhvgvhghhccvfgcbgvh

Q: If the following piece of the partially double stranded DNA: 5' ATCG 3' 3' TAGCGGCATCCG 5' and…

A: Given:  A piece of the partially double-stranded DNA: 5' ATCG 3' 3' TAGCGGCATCCG 5' and add DNA…

Q: 2) Label the coding and the template strand in the table.

A: A                               G    A              C       T   T   A T C           T…

Q: The single strand of DNA below forms a hairpin structure with a loop that is 5 nucleotides long. 5'…

A: Hydrogen bonds between nucleotides that are complementary in the loop and stem regions help to…

Q: The sequence below shows one strand of DNA. Parts of the sequence are in capital letters to help you…

A: Answer a. The sequence of the strand of DNA it would be paired within a double-stranded helix is…

Q: 17. You are presented with the following DNA molecule: 5 ATGCGATTATAA 3' 3' TACGCTA ATATT5' A. Write…

A: Given: A DNA Molecule: 5' A T G C G A T T A T A A 3' 3' T A C G C T A A T A T T 5' DNA =>…

Q: Enter the corresponding section of mRNA produced from the following section of DNA template strand:…

A: DNA or Deoxyribonucleic acid is the genetic material for most higher organisms and some viruses. RNA…

Q: 9. Create a matching (complementary) DNA sequence for the following strand: A A A A A C CGA CCGATC

A: DNA is known to be the largest biomolecule in the cell. It is composed of two polynucleotide chains…

Q: All guanines in the top strand of following sequence undergo a chemical change so that they now pair…

A: Two identical DNA molecules, each made up of one original strand (the template strand) and one…

Q: 3’-T A C G G A C T G A C G A T C-5’ What is its Complementary DNA sequence? mRNA sequence…

A: The term mutation refers to the change of DNA sequence which occurs either due to errors in DNA…

Q: 36/ In the figure representing DNA replication represents the leading strand? AA C.C DD None of the…

A: DNA replication means making a replica or copy of the DNA strands. DNA is a double-stranded…

Q: Induce a silent mutation in the template strand. Illustrate the output.

A: Mutation changes the sequence of nucleotides in a gene. The mutation is a random process.

Q: You have the below template DNA strand. Draw the coding DNA strand and mRNA. Include which ends are…

A: Replication is the process by which the DNA generates a copy of itself. Transcription is the process…

Q: What type of mutation is shown in the diagram?   Why do you think this type of mutation is referred…

A: Mutations are alterations in the gene sequence due to presence or interference of certain mutagenic…

Q: 1. You are provided with the DNA sequence in the leading strand template. See item number 1 in…

A: DNA consist of two strands that run antiparallel to each other . Each strand of DNA consist of…

Q: 3’ – TACGGACTGATAGGCCCGCGCATC-5’ a.Complementary Strand: b. Direct Transcript: c. Transcript for…

A: Molecular Biology is the branch of biology that deals with a study of the composition, arrangement,…

Q: A. DNA Replication Construct a DNA with 15 base pairs. (Note that the first three nucleofides of the…

A: DNA(Deoxy ribonucleic acid) is a double stranded helical structure which is made up of phosphate…

Q: Given Sequence: 5’ – TCAGGACTGATAGGCTAATCGGCCCGCGCACAT-3’   a. Complementary Strand b. Direct…

A: The translation can be defined as a process in which the synthesis of protein from the mRNA occurs.…

Q: A lagging strand is sketched below. The Okazaki fragment DNA is red, and the RNA primers are dashed…

A: Introduction: DNA stands for 'deoxyribonucleic acid' and it is the hereditary material in humans and…

Q: 32) An origin of replication is given below. Sequences of selected parental strand regions are…

A: Introduction The process by which the genome's DNA is copied in cells is known as DNA replication.…

Q: It has been estimated that each phosphate group in B-DNA can form hydrogen bonds with six water…

A: The double-helical structure of DNA which is right-handed with 10-10.5 base pairs in a single turn…

Q: DNA STRAND IS 3’ TAC-AGC-ACT-CAG-TCA 5’, whats the non-template/sense/coding strand from the STARND…

A: During the process of transcription, one of the two DNA strands serves as a template for the…

Q: On paper, replicate the following segment of DNA:            5’ A T C G G C T A C G T T C A C 3’…

A: DNA replication is a complex process of producing copies of the entire chromosome using the…

Dissection

Dissection is the process of cutting up the tissue of a dead or live animal or plant, to do anatomical studies and surgical treatments. The purpose of dissection is to learn more about the overall structure of organs and organ systems and thereby understand the physiology of the organism.