
Human Anatomy & Physiology (11th Edition)
11th Edition
ISBN: 9780134580999
Author: Elaine N. Marieb, Katja N. Hoehn
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
DNA STRAND IS 3’ TAC-AGC-ACT-CAG-TCA 5’
a. what is the non-template/sense/coding strand?
b. What is the arrangement of the m-RNA?
c. What's the chain arrangement of the amino acids that will be made according to the order of the RNA?
d. If on the non-coding strand of DNA there is suddenly one T base that sneaks into the 4th sequence (from the left), or causes a mutation, then how will the RNA be formed?
e. What's the chain arrangement of the amino acids produced by this mutation?
Expert Solution

This question has been solved!
Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.
Step by stepSolved in 3 steps

Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Fill in the palindromic sequence of the given DNA strand containing six bases. 5' GACGTC 3' 3' _ _ _ _ _ 5'arrow_forwardYou have the below template DNA strand. Draw the coding DNA strand and mRNA. Include which ends are 3’ and which are 5’. template DNA 3’ CCTACGGTTCGTACCCCGTATGTGTAACTTGTCAT 5’arrow_forwardNumber 7arrow_forward
- A lagging strand is sketched below. The Okazaki fragment DNA is red, and the RNA primers aredashed orange lines. Which Okazaki fragment was made first? When ligase joins fragments Aand B, will it act at arrow 1, arrow 2, or both?arrow_forward32)An origin of replication is given below. Sequences of selected parental strand regions are given. The directionality of the bottom parental strand is indicated. Use the diagram to answer the corresponding questions. #2 *1 CTAAGCA ATCGAGG XXXXX XXXX 3' ICTAGTT 5' ge exon #3 a.) On the diagram, label the 5' and 3' end of the top strand of parental DNA b Draw arrows to indicate direction of DNA synthesis for each of the 4 daughter strands. e) For each daughter strand, specify if synthesis is continuous or discontinuous. d) On your diagram, label the 5' and 3' ends of the newly synthesized daughter strands e.) Which parental strands are the template for leading strand synthesis? (# 1- 4) Strand # Strand # f.) Which parental strands are the template for lagging strand synthesis? (# 1- 4) Strand # Strand # g.) What is the specific sequence of the primer required to start DNA replication ior strands 1 and 3? Assume the primer will bind to the location where the base sequence is given on…arrow_forwardLabel the diagram to the corresponding letterarrow_forward
- DNA STRAND IS 3’ TAC-AGC-ACT-CAG-TCA 5’, whats the non-template/sense/coding strand from the STARND DNA? also what's the arrangement of m-RNA and the chain arrangement of the amino acids that will be made according to the order of the RNA?PLS DONT ANSWER THE DEFINITION ONLY, READ THE QUESTION CAREFULLYarrow_forwarddraw the structure of the polynucleotide GTarrow_forwardThe line below depicts a DNA segment from a eukaryote. In this case, only the top, coding strand, is shown which is ok for our purposes (but remember that the other strand would also be present in DNAà but it is ok for us to ignore). This is very similar to a problem on the old tests. For each letter state the structure or the function of what occurs at that region. Letter A is Letter B is Letter C is Letter D is Letter E is Letter F is Letter G is To which region/letter would RNA Polymerase bind To which region/letter GTF bind Label the position of the start codon ATG and the stop codon TGA The picture below is for the question itselfarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education

Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON

Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax

Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,

Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company

Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.

Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education