A group of membrane proteins can be extracted from membranes only by using detergents. All the proteins in this group have a similar amino acid sequence at their C-terminus: -KKKKKXXC (where K stands for lysine, X stands for any amino acid, and C stands for cysteine). This sequence is essential for their attachment to the membrane. What is the most likely way in which the C-terminal sequence attaches these proteins to the membrane? The cysteine residue is covalently attached to a membrane lipid. The peptide spans the membrane as an α helix. The peptide spans the membrane as part of a β sheet. The positively charged lysine residues interact with an acidic integral membrane protein.

Q: You are studying a eukaryotic protein PKK in the lab. You fuse the DNA encoding GFP (green…

A: Proteins synthesized through translation process is directed to specific locations in the cells.…

Q: A fragment of a polypeptide, Met-Thr-Ile-Ser-Asp-Ile is encoded by the following sequence of DNA:…

A: The Central dogma defines how DNA codes for proteins, which occur in three stages: replication,…

Q: Why does the protein Piezo have so many tra

A: Piezo proteins have recently been identified as ion channels mediating mechanosensory transduction…

Q: In eukaryotic cells, secreted proteins are initially directed to the endoplasmic reticulum and then…

A: Introduction The secretory pathway refers to the endoplasmic reticulum, Golgi apparatus and the…

Q: B) We also know from studies of protein structure that one turn of an a-helix includes 3.6 amino…

A: Given Values: Number of residues in a helical turn = 3.6 amino acids The distance covered by a turn…

Q: Which of the following parts of translation is significantly different in eukaryotes and…

A: mRNA or messenger RNA carries genetic information as nucleotide sequence copied from template DNA…

Q: Consider a portion of a gene in a cell with the sequence TTTTT. Which of the following bases would…

A: The correct answer is C) A-A-A-A-A; nucleus .

Q: If DNA codes for mRNA and mRNA codes for protein, then how can the same DNA sequence generate…

A: If DNA codes for mRNA and mRNA codes for protein, then how can the same DNA sequence generate…

Q: A gene normally contains an N' terminal ER signal sequence and an internal stop transfer sequence.…

A: Answer :- Option (A) are the best represents the orientation of the protein product after…

Q: The following RNA sequence represents a small messenger which can be translated in a prokaryotic…

A: The first step in translating an RNA sequence into a protein is to divide the sequence into codons,…

Q: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a…

A: In cell protein formed according to the sequence on mRNA. mRNA is formed from DNA sequence by the…

Q: In EUKARYOTIC translation, how does initiation of translation occur? a) What components of the…

A: The process of decoding the genetic information carried by mRNA molecules in order to synthesize…

Q: A useful technique for studying microtubule motors is to attach them by their tails to a glass…

A: Microtubules, like actin filaments, are dynamic structures: they can grow and shrink quickly by the…

Q: Given the following DNA, (A) what is the transcript (mRNA) sequence? (B) What might be the amino…

A: Given: DNA sequence

Q: In diseases such as Creutzfeldt-Jakob disease (CJD), a normal prion protein becomes infectious and…

A: Creutzfeldt-Jakob Disease:  Creutzfeldt-Jakob disease (CJD) is a neurodegenerative disease that…

Q: The transmembrane segments of most integral membrane proteins are made of alpha -helical secondary…

A: The α-helix is a common element of protein secondary structure, formed when amino acids “wind up” to…

Q: Mild detergents, like Triton X-100, would be the best for isolation of peripheral proteins from the…

A: The cell membrane is a structure which protects the cell and acts as a barrier and transports the…

Q: For translation of eukaryotic mRNA sequences: a) The stop codon stops translation by blocking the…

A: Translation refers to the process of polymerisation of amino acid to form a polypeptide. The order…

Q: Consider the following DNA sequence, which codes for a short polypeptide:…

A: A codon is a sequence of three nucleotides (in DNA or mRNA) that specifies a particular amino acid…

Q: translation to the plasma membrane

A: Translation is a process in which mRNA is decoded into short peptide sequences made of amino acids.…

Q: A certain membrane protein is found on the ER membrane with the N-terminus on the ER side of the…

A: This question is about the orientation of a particular membrane protein within the endoplasmic…

Q: Which of the following is a reason why codons are NOT composed of only two nucleotides? Question 22…

A: The biochemical substance that is carried forward from the preceding generation to the succeeding…

Q: The following sequence is a portion of the N-terminus of the ACE2 receptor.  The secondary structure…

A: Each amino acid has a different property.

Q: There are two ways in which rearrangement of domain- encoding gene segments can result in novel…

A: Introduction Prokaryotes: These are the organisms which have characteristic nucleoid rather than…

Q: The genetic code is thought to have evolved to maximize genetic stability by minimizing the effect…

A: Mutation is the alteration in the genome sequence. It can occur in the genetic code of eukaryotes,…

Q: Trace the pathway of a protein from translation to the plasma membrane. You may name this protein…

A: Membrane proteins are a part of membrane structure, which are very important for a cell to carry out…

Q: UACTyrosine (Tyr) Fcysteine (Cys) Consider the following DNA coding strand: 5' - ATGTACGGC GAATAA-3'…

A: Within the biological system, the flow of genetic information is explained as molecular biology's…

Q: Erk and P-Erk live in two different locations within the cell even though they are just two…

A: * Mitogen activated protein kinase also called as  MAPK and  p42MAPK, and ERK2 * It is an enzyme…

Q: ONE ultimate destination of a protein produced on an attached ribosome, and ONE general function of…

A: Proteins are large, complex, macromolecules made up of smaller building blocks which are called…

Q: T F T F T T F F The major bonds in cellulose are a(1-4) bonds. Answer: During mRNA splicing, U2…

A: Introduction :- mRNA splicing is a post-transcriptional process in which introns (non-coding…

Q: A polypeptide is cleaved into peptides by treatment with trypsin and cyanogen bromide, and then the…

A: Trypsin cleaves specifically peptide bonds at the C-terminal side of lysine (K) and arginine (R)…

Q: Given the following sequence of a coding DNA strand: AGTTGCGCATGCCAGAGAGGTTCGAGTGCACATAACTTGAG The…

A: DNA is a double stranded molecule with coding strand and template strand. Template strand is the one…

Q: You are treating a patient suffering with wound botulism in which Clostridium botulinum grows in a…

A: Antibiotics are the medicines which are used to cure infections which are caused by bacteria. These…

Q: Microfilaments work together with the protein blank to cause movement in cells. provide two…

A: Microfilaments, also called actin filaments (as they are composed of two strands of actin protein…

Q: In the early days of ribosome research, before the exact role of ribosomes was clear, a researcher…

A: Ribosomes : Ribosomes are the sites at which information carried in the genetic code converted into…

Q: A gene normally contains an N' terminal ER signal sequence and an internal stop transfer sequence.…

A: Option ( b)

Q: Trace the pathway of a protein from translation to the plasma membrane. You may name this protein…

A: In this task, we will explore the pathway of a trans membrane protein, using the Transferrin…

Q: EF-G is a macromolecular mimic of EF-tu. It's role in translation is to To cause the large subunit…

A: Translation is the synthesis of the  protein from m RNA. There are various initiation and elongation…

Q: In the eukaryotic cell, the members of the endomembrane system work together to synthesize protein…

A: The endomembrane system is an interconnected system of intracellular membrane-bound organelles and…

Q: Consider two different proteins that are leaving from the Golgi in order to arrive in their common…

A: Cells are made up of several components that allow them to function effectively. The cytoplasm is…

Q: You fuse the DNA encoding GFP (green fluorescent protein) to the C terminus of the PKK gene. You…

A: Answer :-  - This fusion protein is a cell membrane protein. - This fusion protein is a nuclear…

Osmosis

In simple words, osmosis is the slow, gradual movement of a liquid through a membrane. But there are nuances to this process. For instance, there has to be an imbalance in the distribution of solute in the liquid on either side of the membrane, which has to be semipermeable. The liquid in the region with a lower solute concentration moves to the region with a higher concentration, thereby displacing the solution in the process. The objective is to equalize the concentration of molecules on both sides of the membrane; the displacement of liquid can be viewed as a byproduct of this equalization. Since there is no energy required to carry osmosis, it is considered a passive process.