7. The coding region of the human insulin gene includes an (endoplasmic reticulum) ER signal sequence. a. Why is the presence of the ER signal sequence necessary? You wish to express human insulin in a bacterial cell using recombinant DNA technology. Steps of the procedure include: 1. insert the human insulin gene into a plasmid, 2. transform the plasmid into bacteria cells, 3. grow transformed bacterial cells in culture conditions that allow for expression of the insulin gene, 4. collect the cells and lyse them for purification of the desired human insulin protein. b. Regarding the first step, is it necessary to include the ER signal sequence in the DNA fragment coding for the human insulin gene? Briefly explain your answer. c. Why is cloning with restriction enzymes that leave sticky ends more efficient than cloning with restriction enzymes that leave blunt ends? d. In step 2 you need to select for cells that have taken up the plasmid DNA. How can you differentiate between cells with and without plasmid DNA?

7. The coding region of the human insulin gene includes an (endoplasmic reticulum) ER signal sequence. a. Why is the presence of the ER signal sequence necessary? You wish to express human insulin in a bacterial cell using recombinant DNA technology. Steps of the procedure include: 1. insert the human insulin gene into a plasmid, 2. transform the plasmid into bacteria cells, 3. grow transformed bacterial cells in culture conditions that allow for expression of the insulin gene, 4. collect the cells and lyse them for purification of the desired human insulin protein. b. Regarding the first step, is it necessary to include the ER signal sequence in the DNA fragment coding for the human insulin gene? Briefly explain your answer. c. Why is cloning with restriction enzymes that leave sticky ends more efficient than cloning with restriction enzymes that leave blunt ends? d. In step 2 you need to select for cells that have taken up the plasmid DNA. How can you differentiate between cells with and without plasmid DNA?

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter14: Biotechnology And Society

Section: Chapter Questions

Problem 13QP

See similar textbooks

Similar questions

In biotechnology, gene cloning is a very important technique. A vector is normally required to perform this process. The vector commonly used to transform a bacterial host cell is the plasmid. State the three (3) important regions of the plasmid. Elaborate your answer.
In cancerous cells, telomeres are substantially longer then telomeres found in non-cancerous cells. As a result a number of scientists who study cancer treatment have become interested in telomerase. Why might telomerase be a good target for anticancer therapies? How might anticancer therapies targeting telomerase work (no need to design an experiment, just brainstorm how the therapy might impact telomeres of cancer cells)?
A.) Transformation is best described as: Group of answer choices The integration of foreign DNA into a genome The uptake of naked DNA from the environment The transfer of DNA via a bacteriophage Transfer of a plasmid from one organism to another B.) What is the function of the araC gene in the pGLO plasmid? Group of answer choices It encodes the protein that glows under ultraviolet light It allows us to select for the cells that contain the plasmid It prevents the transcription of the green fluorescent protein unless arabinose is added It ensures that the plasmid will be copied and passed on to daughter cells C.) What is the function of the bla gene in the pGLO plasmid? Group of answer choices It encodes the protein that glows under ultraviolet light It allows us to select for the cells that contain the plasmid It prevents the transcription of the green fluorescent protein unless arabinose is added It ensures that the plasmid will be copied and passed on…
4) List 3 things that a potential vector must have in order to be useful. 5) Sometimes the gene for the enzyme glutathione-S-transferase (GST) is used in purifying your protein of interest. Briefly explain how this is done. 6) What enzyme is used to create CDNA from MRNA?
#3) Ligase catalyzes a reaction between the 5' phosphate and the 3' hydroxyl groups at the end of DNA molecules. The enzyme calf intestinal phosphatase catalyzes the removal of the 5' phosphate from DNA molecules. What would be the consequence of treating a cloning vector, before ligation, with calf intestinal phosphatase?
1. Restriction enzymes are extensively used in molecular biology. Below are the recognition sites of two of these enzymes, BamHl and Bcll. a) Shown below is a BamHI recognition site, which cleaves after the first G. Does cleavage by BamHl result in a 5' or 3' overhang? 5... G'GATCC...3 3...CCTAGG...5 b) Shown below is a Bcll recognition site, which cleaves cleaves after the first T. Does cleavage by Bcll result in a 5' or 3' overhang? 5... TGATCA...3 3... ACTAGT...5 You are given the DNA shown below. 5' ATTGAGGATCCGTAATGTGTCCTGATCACGCTCCACG 3' 3' TAACTCCTAGGCATTACACAGGACTAGTGCGAGGTGC 5' c) If the above DNA was cut with BamHI, how many DNA fragments would you expect? Write out the sequence of these double-stranded fragments. d) If the above DNA was cut with Bcll, how many DNA fragments would you expect? Write out the sequence of these double-stranded fragments. e) If you ligate or join the smaller restriction fragment in step c with the smaller restriction fragment in step d, what would…
1. Restriction enzymes are extensively used in molecular biology. Below are the recognition sites of two of these enzymes, BamHI and Bcll. a) Shown below is a BamHI recognition site, which cleaves after the first G. Does cleavage by BamHI result in a 5' or 3' overhang? 5... GGATCC...3' 3...CCTAGG...5' b) Shown below is a Bcll recognition site, which cleaves cleaves after the first T. Does cleavage by , Bcll result in a 5' or 3' overhang? 5... TGATCA...3' 3'... ACTAGT.. 5' You are given the DNA shown below. 5 ATTGAGGATCCGTAATGTGTCCTGATCACGCTCCACG 3' 3' TAACTCCTAGGCATTACACAGGACTAGTGCGAGGTGC 5' c) If the above DNA was cut with BamHI, how many DNA fragments would you expect? Write out the sequence of these double-stranded fragments. d) If the above DNA was cut with Bcll, how many DNA fragments would you expect? Write out the sequence of these double-stranded fragments. e) If you ligate or join the smaller restriction fragment in step c with the smaller restriction fragment in step d, what…
1. You have the plasmid pUC18/19, which is a circular plasmid that consists of 2686 bp. What would the number of and length of the fragments be if you cut the plasmid with the following restriction enzymes or combination of enzymes? Give a schematic representation of the digestions. a. PscI & GsuI b. ScaI, PdmI & BsaXI c. ScaI, SspI & EheI 2. You have determined that the amplicon you want to clone has enzyme restriction sites for HindIII and EcoRI. After investigation you have seen that the pUC18/19 plasmid also have these enzyme restriction sites in its multiple cloning site (MCS on map above). After enzyme digestion your amplicon is 854 bp long. a. What length will the recombinant plasmid be after you have inserted your amplicon? Show your calculation. b. In the amplicon insert you have an enzyme restriction site for NdeI at 500 bp. If you digest the recombinant plasmid with this enzyme what length will the fragments be?
Choose the proper order for recombinant protein purification from bacterial cells. a. lysis,pelleting by centrifugation, induction of protein expression, transformation, purification by chromatography b. induction of protein expression, transformation, pelleting by centrifugation, lysis, purification by chromatography c. transformation, induction of protein expression, pelleting by centrifugation, lysis, purification by chromatography d. purification by chromatography, lysis, pelleting by centrifugation, induction of protein expression, transformation
Which one of the following statements is true? a. Dideoxynucleotides signal the end of DNA replication in a cell b. None of the provided answers are true c. The DNA sequence determined by an autoradiogram should be identical to the template strand DNA sequence d. The probe hybridization solution used in the Sothern blot technique is approximately pH 10.0 e. The transfer buffer used in the Southern blot technique is approximately pH 7.0
Bacteria can be used to produce human growth hormone (HGH - a peptide/protein) through genetic engineering. The human gene for HGH is inserted into a plasmid, which is then taken up by a bacterial cell, which divides and multiplies into a clone of cells, all of which contain the plasmid with the HGH gene. The bacteria express the HGH gene, producing HGH which can be harvested and used for treatment of humans. (See figure below) Which of the following statements is NOT true about this process? bacterium Vector, such as a DNA containing the gene of plasmid, isolated it from a different species is Gene encoding protein for pest resistance is inserted into plant cells ©2019 Pearson Education, Inc chromosome recombinant DNA (plasmid) transformed bacterium Create and harvest copies of a gene with either of two goals in mind. Gene encoding degradative enzyme to clean up toxdo waste is inserted into bacterial cells ved by an enzyme into gene of interest The desired gene is selected and…
1. You are working with a known chemical that can cause a mutation in the DNA. You decide to use the Replica Plating experiment to confirm that this is the case. Please talk about how this experiment works. Also, please discuss any two types of mutations that could take place due to this mutation and what these mutations can cause when DNA is made into protein. 2. What is a difference between prokaryotic and eukaryotic gene expression? Please explain. Also, discuss briefly the significance in splicing, why this is done and how this leads into variety of different polypeptides.