5. Draw the major components of the DNA Pol III replication complex in the context of a replication fork. Be sure to illustrate and label the leading and lagging strands, RNA primers, Okazaki fragments, the polymerase core, the beta-clamp subunits, and the clamp loader complex, and show how the lagging strand is threaded through the replication complex.

5. Draw the major components of the DNA Pol III replication complex in the context of a replication fork. Be sure to illustrate and label the leading and lagging strands, RNA primers, Okazaki fragments, the polymerase core, the beta-clamp subunits, and the clamp loader complex, and show how the lagging strand is threaded through the replication complex.

Name: 5. Draw the major components of the DNA Pol III replication complex i
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: 5. Draw the major components of the DNA Pol III replication complex in the context ofa replication fork. Be sure to illustrate and label the leading and lagging strands,RNA primers, Okazaki fragments, the polymerase core, the beta-clamp subunits,and

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter14: Dna Structure And Replication

Section: Chapter Questions

Problem 13TYK

See similar textbooks

Similar questions

1. On a piece of paper, replicate the following segment of DNA: 5’ ATCGGCTACGTTCAC 3’ 3’ TAGCCGATGCAAGTG 5’ a.) show the direction of replication of the new strands and explain what the lagging and leading strands are. b) Explain how this is semiconservative replication. Are the new strands identical to the original segment of DNA? 2. Createyour own an Illustration of the Central Dogma. Provide your own DNA segment. Use the previous topics as reference.
3) 6. What is the main reason for there being both a leading and a lagging strand during DNA replication? To answer the question please: traw a scheme of DNA replication and mark the direction of replication fork movement; 2) name the proteins that are required for DNA replication. monar initiate
21. During replication one of the parent strands is oriented 3' to 5' direction toward the replication fork and the synthesis of the new strand can continue without interruption as the helicase continues unwinding. The other parent strand runs 5' to 3' direction leaving the synthesis of the new strand to continue in the opposite direction and away from the replication fork. This causes generation of DNA fragments to be attached later. This strand is called lagging strand. True False
1. The image shown in Figure 1 below represents a strand of DNA following replication. The black lines present above the top and below bottom strands of DNA represent the phosphodiester backbone of the molecule. Examine the DNA strands and locate any sites that are damaged, mismatched, or otherwise require repair. Indicate where in the strand the specific lesion is located, and provide a detailed overview of the post-replicative repair process that would likely be used to rectify the lesion. Assume that each lesion, even those that are located in close proximity will be repaired separately. CH, CH, OCH, CH, OCH₂CH, GATCCGAATCGGCTAGGATCGGCATCCGATTCGATCGGCATCCGATCGCTAGCO CH, CH, CH, CH, CH, TACGATCGATC CTAGGATTA CCGACCCTAGCCGTAGGGTAACGTAGCCGTAGGCTAGCGACCGGGGATGCTAGCTAG Figure 1: Graphical Representation of a strand of dsDNA containing errors and damage following replication
10. A picture of a replication bubble is shown below. でイトイOpイ TT 3 Primer 5'-CUU-3" is being used to replicate this picce of DNA. What strand this primer will anneal to: the upper or the lower? Write what product of RNA replication would be the first five nucleotides that had been added onto the primer by DNA pol. Mark the 5' and 3' ends. lin
4) Replication of a circular DNA molecule can occur by either theta replication or by rolling circle replication. Describe or explain three differences between these two modes of DNA replication (you must accurately describe the differences between the two - an accurate statement about one form of replication that does not clearly indicate how the other form differs will not answer the qestion in it's entirety).
3. Draw a molecule of DNA undergoing theta replication. On your drawing, identify (a) the origin of replication, (b) polarity (5' and 3' ends) of all template strands and newly synthesized strands, (c) leading and lagging strands, (d) Okazaki fragments, and (e) locations of primers.
19. Match the letters with the enzymes and macromolecules involved in DNA replication: A E B DNA POLYMERASE CATALYZES COMALENT LINKAGE OF NUCLEOSIDE TRIPHOSPHATE INTO GROWING NEW STRAND INCOMING NUCLEOSIDE D' TRIPHOSPHATE PAIRS WITH A BASE IN THE TEMPLATE STRAND A) i) pyrophosphate (Pi) ii) template strand ii) incoming nucleoside triphosphate iv) new strand v) DNA polymerase
1. For each of the items below, give a brief description (indicate function for enzymes) and indicate in which process (replication, transcription, or translation) it is involved with. Description/Funetion catalyzes the unwinding of DNA strands Process involved in helicase replication 1. RNA primer 2. leading strand 3. RNASE 4. anti-sense strand 5. anticodon 6. RNA polymerase II 7. DNA polymerase 8. promoter site 9. DNA ligase 10. exit site
18. If 32P is used to label both strands of double-stranded DNA, after two rounds of replication, four double-stranded molecules of DNA are produced. Of these,a. one of the four double-stranded molecules of DNA will contain all the 32Pb. two of the four double-stranded molecules of DNA will contain 32P, each with half of the 32Pc. three of the four double-stranded molecules of DNA will contain 32P, each with 1/3 of the 32Pd. all four double-stranded molecules of DNA will contain 32P, each with ¼ of the 32Pe. none of the double-stranded molecules of DNA will contain 32P
11. Refer to the figure showing a single replication fork. Which statement about the replication fork shown is false? O The replication fork is advancing to the left. O The top template strand is oriented in the 5'-to-3 direction from left to right. O DNA polymerase would be "reading" the top template strand from right to left. The origin of replication is at the position labeled A.
32)An origin of replication is given below. Sequences of selected parental strand regions are given. The directionality of the bottom parental strand is indicated. Use the diagram to answer the corresponding questions. #2 *1 CTAAGCA ATCGAGG XXXXX XXXX 3' ICTAGTT 5' ge exon #3 a.) On the diagram, label the 5' and 3' end of the top strand of parental DNA b Draw arrows to indicate direction of DNA synthesis for each of the 4 daughter strands. e) For each daughter strand, specify if synthesis is continuous or discontinuous. d) On your diagram, label the 5' and 3' ends of the newly synthesized daughter strands e.) Which parental strands are the template for leading strand synthesis? (# 1- 4) Strand # Strand # f.) Which parental strands are the template for lagging strand synthesis? (# 1- 4) Strand # Strand # g.) What is the specific sequence of the primer required to start DNA replication ior strands 1 and 3? Assume the primer will bind to the location where the base sequence is given on…