6a. Given the following mutated sequence (with respect to the normal sequence), what TYPE of mutation occurred: AAGCTTAC 6b. Where did the mutation take place?
Q: Define a mutation. Are they good or bad? What types of mutations can occur in the DNA? What…
A: A permanent modification in the DNA sequence that makes up a gene, such that the sequence differs…
Q: describe the normal role of the component, and choose from the selection the most direct effect of…
A: Mutations are the defective change in DNA. Mutations basically changes the base pair sequence of DNA…
Q: Describe in detail three spontaneous lesions that can lead to mutations. Give examples.
A: Three spontaneous lesions are depurination, deamination, and transversions. 1. Depurination occurs…
Q: What causes mutation? Is it always harmful? • Does a simple change on DNA sequence affect the…
A: DNA or deoxyribonucleic acid is the genetic material in living organisms. It is composed of…
Q: 5. The nucleotide sequences of the DNA molecules in the figure below were obtained from four…
A: Deoxy ribonucleic acid (DNA) is the genetic material that contains coded genetic sequence in the…
Q: 21. Describe three specific examples of free radical damage to DNA. Briefly describe the chemical…
A: Free radical damage to DNA It can occur as a consequence of exposure to ionizing radiation due to…
Q: Explain TWO (2) differences between two commonly used ligases; F. coli DNA ligase and T4 DNA ligase.
A: During DNA cloning process , various restriction enzymes like exonucleases and endonuclease as well…
Q: Explain Synthetic Lethal Mutations.
A: The mutation is caused due to alteration occurred in the gene sequence due to either environmental…
Q: Explain point mutations and frameshift mutations. Which is more apt to disrupt the structure and…
A: Proteins are the expression of the information present in the DNA (deoxyribonucleic acid). This…
Q: Why is DNA pol III still a thing, given that it lacks some of the functionality of DNA pol I - why…
A: The Central Dogma concept is a very important part of Molecular Biology. It states that "DNA makes…
Q: What are the advantages and disadvantages of mutation?
A: "Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: explain substitution, insertion, and deletion gene mutations including the potential results of the…
A: Gene mutation is the alternation of the nucleotide sequences in the the DNA. In DNA four types of…
Q: Identify (circle the mutation in the mutated sequence) and name the type of mutation that occurred.
A: # Here I have given solution of mutations only , please send next question related to genetics…
Q: Define FOUR (4) types of point mutations within coding sequences
A: Coding sequences are the sequence of nucleotides in DNA capable to produce a protein. Many mutations…
Q: The letters ABCDEFGH represent a normal DNA sequence. Indicate the type of mutation present in each…
A: Whenever there is a normal DNA sequence, but after DNA replication, or due to cellular stress or due…
Q: 19.Examine the following DNA sequence and determine what type of mutation, if any, produced the…
A: Mutations are certain modifications takes place in the sequence in DNA . Mutations is classified as…
Q: Given the following mutated sequence (with respect to the normal sequence), what TYPE of mutation…
A: Mutation is the genetic change in the genome due to the gain or loss of any gene. These changes may…
Q: 6. Why do you think the Ames test is preferable to the use of animal models to screen chemical…
A: Ames test is used to find whether a given chemical causes mutation in the DNA in the animal models.…
Q: 30) In the CRISPR system, the targeted DNA sequence is
A: CRISPR stands for clustered, regularly interspaced short palindromic repeats. Engineered CRISPR…
Q: 28. What type of mutation is seen here? WT: 5′-AUG GCU AGA GUU GAA AAA-3′…
A:
Q: 21. Which of the following mutations would be expected to have the most harmful effect on the…
A: "Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: explain Instability of TE insertion mutations
A: Transposable elements (TEs) are deoxyribonucleic acid (DNA) sequences that move from one location to…
Q: Describe or explain how the presence of a thymine dimer in DNA being used as the template strand…
A: The mutation is the sudden deleterious effects in the DNA sequences, they can arise when the DNA is…
Q: Describe three types of mutations
A: A mutation is a change in a DNA sequence. Mutations can result from mistakes happened during DNA…
Q: (a) Which of the following statements is TRUE? DNA polymerase moves in a 5 to 3 direction in…
A: The biological process by which the information encoded inside a DNA (deoxyribonucleic acid)…
Q: 12. If this is the base sequence of DNA, what is the resulting AA sequence for the following…
A: Mutations When the sequence of DNA is altered it is said that the DNA is mutated. Mutations causes…
Q: 1. Where is the cleavable blocker located on the modified nucleotides used in Illumina sequencing?
A: Illumina sequencing is developed by Solexa and was subsequently acquired by Illumina. This…
Q: 21. What are the similarities and differences between the lactase persistence mutations found in…
A: Mutation can be defined as the change which occurs in the DNA which resulted in either addition or…
Q: 7. Describe the mutation that causes sickle cell anemia. a. What is the change that occurs in DNA?…
A:
Q: TACAT
A: Solution :There are three types of DNA Mutations: base substitutions, deletions and insertions.
Q: Please explain the different type of mutations and how do they  occur?
A: Mutation is change taking place in sequence of DNA which can occur either because of mistake during…
Q: Which of the following best describes this type of mutation? Original – CCU-GAU-GAG-UCA…
A: Introduction : Mutations are modifications to the genetic sequence. Mutations can involve the…
Q: What is the mechanism of action of ultraviolet radiation in bacterial mutation?
A: Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: 1. What is mutation? Explain the random and site-directed mutagenesis methods .Which one is…
A: Since you have posted a question with multiple sub-parts, we will solve first three questions for…
Q: What are the chances of occurence of amorphic mutation?
A: Mutations are defined as the change in the sequence of DNA of an organism due to any environmental…
Q: 1.Photoreactivation is called a direct reversal of DNA damage. Mismatch repair, Nucleotide excision…
A: The presence of mutation in the genome gives rise to genetic variations. These variations are…
Q: Explain why STR mutations are found at a much higher frequency than single nucleotide changes?
A: STR means single tandem repeat, and the mutation in the STR segments is at a very high rate .
Q: List the complementary non-coding DNA sequence. CCUGCAGUAUGAAACGCCUGGUAGAAGGUGGGAAGUGGUGCGCCC . . .
A: DNA consist of a double-helical structure where one strand is called a sense strand or non-coding…
Q: Describe some mutation repair mechanisms.
A: Mutations are the change in the genetic sequence of the individual due to external factors. If these…
Q: 23 Which of the following statements about mutations are true?
A: The mutation is defined as a sudden, inheritable change in a DNA sequence. The process includes the…
Q: 32. Why is it necessary to modify the RNA molecule?
A: RNA modification affects the activity, localization as well as stability of RNAs. It occurs in all…
Q: 40) What external factor (aka, damaging agent) gives rise to the following DNA mutations? Write and…
A: Multiple questions with three parts are asked. I will answer for the question A , as per guidelines.…
Q: Discuss the possible effects of mutations
A: A mutation is the change in the nucleotide sequence of a DNA molecule. Mutation may arise due to any…
Q: Explain the term mutation.
A: Genes carry coded genetic information in the form of specific nucleotide sequences. This specific…
Q: 7. Discuss the modes of actions by which the following three compounds disrupt DNA- associated…
A: Whether its a cancer cell trying to multiply inorder to generate more cancer cell or a pathogen…
Q: Describe the different kinds of mutations.
A: A mutation is an adjustment in the nucleotide succession of the genome of an organic entity,…
Q: Sickle cell hemoglobin DNA CACGTAGACTGAGGACAC.. io.. A ... C... Sickle cell hemoglobin MRNA: Sickle…
A: Mutations are the change in the sequence of the DNA. Even a change in single base pair produces…
Q: Discuss the types of mutations (chromosome and gene mutations).
A: Mutation is any change in the DNA sequence that an ultimately responsible for a point mutation or…
Q: silent mutation in DNA
A: Mutation can be defined as the change in the nucleotide sequence of a gene or a chromosome.…
6a. Given the following mutated sequence (with respect to the normal sequence), what TYPE of mutation occurred: AAGCTTAC
6b. Where did the mutation take place?
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- A polypeptide has the following amino acid sequence: Met-Ser-Pro-Arg-Leu-Glu-Gly The amino acid sequence of this polypeptide was determined in a series of mutants listed in parts a through e. indicate the type of mutation that occurred in the DNA (single-base substitution, insertion, deletion) and the phenotypic effect of the mutation (nonsense mutation, missense mutation, frameshift, etc.). a. Mutant 5: Met-Ser-Pro-Arg-Leu-Leu-Glu-GlyA polypeptide has the following amino acid sequence: Met-Ser-Pro-Arg-Leu-Glu-Gly The amino acid sequence of this polypeptide was determined in a series of mutants listed in parts a through e. indicate the type of mutation that occurred in the DNA (single-base substitution, insertion, deletion) and the phenotypic effect of the mutation (nonsense mutation, missense mutation, frameshift, etc.). a. Mutant 2: Met-Ser-ProA polypeptide has the following amino acid sequence: Met-Ser-Pro-Arg-Leu-Glu-Gly The amino acid sequence of this polypeptide was determined in a series of mutants listed in parts a through e. indicate the type of mutation that occurred in the DNA (single-base substitution, insertion, deletion) and the phenotypic effect of the mutation (nonsense mutation, missense mutation, frameshift, etc.). a. Mutant 1: Met-Ser-Ser-Arg-Leu-Glu-Gly
- BM4_DNA AND PROTEIN S X /1FAIPQLSDP_g5B-629FSHNpGnTMIEppLS4A71zBd4vcUBqNUILubXONw/formResponse 4. What is the nitrogen base pair of Adenine in transcription? O Cytosine O Uracil O guanine O thymine 5. The central dogma of Molecular Biology states that There are four nitrogen bases in DNA, two purines (adenine and guanine) and two pyrimidines (cytosine and thymine). Which process is not included in the central dogma? duplication transcription translation O translocation LeadpleSickle-cell hemoglobin differs from regular hemoglobin in just one amino acid. Normal hemoglobin is created from the codon GAA, which codes for glutamic acid while sickle-cell hemoglobin has the codon GUA, which codes for valine. This is an example of what type of mutation? * O Insertion O Silent mutation O Deletion O Substitution mutationA wildtype gene produces the polypeptide sequence: Wildtype: Met-Ser-Pro-Arg-Leu-Glu-Gly Each of the following polypeptide sequences is the result of a single mutation. Identify the most likely type of mutation causing each, be as specific as possible. M1:Met-Ser-Ser-Arg-Leu-Glu-Gly missense mutation M2:Met-Ser-Pro M3:Met-Ser-Pro-Asp-Trp-Arg-Asp-Lys M4:Met-Ser-Pro-Glu-Gly nonsense mutation frameshift insertion in frame deletion M5:Met-Ser-Pro-Arg-Leu-Glu-Gly in frame insertion
- Given the following Wild Type and Mutated DNA sequences: 1.) Identify where the base pair change occurs ( what letter changed?) 2.) For BOTH sequences, write the mRNA strands, define the codon regions and amino acid sequences. 3.) Describe what kind of mutation has occurred (missense, nonsense, or silent), and what effect this may have on the protein. Wild Type DNA Sequence: 3' - AGGCTCGCCTGT - 5' Mutated DNA Sequence: 3' - AGTCTCGCCTGT - 5'Based on the following wild type DNA sequence, indicate if each of the mutations should be classified as : insertion, deletion, missense, nonsense, silent (Use the provided Genetic Code table and remember you have been given DNA sequence). Wild Type: AUGAUUCUUAAAAGU Mutant 1: AUGAUUCUUUAAAGU Mutant 2: AUGAUUCUUGAAAGU Mutant 3: AUGAUCCUUAAAAGU Mutant 4: AUGAUCCUAAAAGU Mutant 5: AUGAUCCUUAAACAGU Socond letter Key: Ala = Alanine (A) Arg Arginine (R) Asn = UUU } UAU Tyr UGU UGC Cys UGA STOP UGG Trp UCU UCC UUC Phe Ser Asparagine (N) Asp = Aspartate (D) Cys Cysteine (C) Gin = Glutamine (Q) Glu = Glutamate (E) Gly = Glycine (G) His = Histidine (H) le = Isoleucine (1) Leucine (L) Lys Lysine (K) Met = Methionine (M) Phe = Phenylalanine (F) Pro Proline (P) Ser = Serine (S) Thr Threonine (T) Trp Tryptophan (W) Tyr Tyrosine (Y) - Valine (V) UCA UCG UAA STOP UAG STOP UUA Leu UUG S CCU CC CGU CUU CUC His CGC Arg Leu Pro CAA Gin CGA CCA CCG CUA CUG CGG Leu = AGU AUU AUC } lle AUA ACU ACC ACA Ser AAC…Cynt Classifying mutations A certain section of the coding (sense) strand of some DNA looks like this: $-ATGTATATCTCCAGTTAG-3" It's known that a very small gene is contained in this section. Classify each of the possible mutations of this DNA shown in the table below. mutant DNA 5- ATGTATCATCTCCAGTTAG-3' S-ATGTATATCTCCAGTTAG-3 5- ATGTATATATCCAGTTAG-3' type of mutation (check all that apply) insertion deletion point silent noisy insertion O deletion point silent noisy insertion O deletion point silent Onoisy X G
- +1 1 2 4 6. 7 8. 9. Transcriptional stop sequence ТАTА box ATG ТА AUG UAA Here is a diagram of a human gene in the genome. The bar above it is indicating different regions of the gene sequence. 7. Which region or regions contain the sequences that direct splicing? - 8. In which region or regions could a single base pair insertion cause a frameshift mutation (but not because of changed splicing)? - 9. In which region or regions might you find sequences that control the amount of transcription of this gene? + 10. In which region or regions could a single base pair deletion cause the mRNA to be one base pair shorter? - 11. Which region or regions usually contain a sequence that controls the secretion of the protein e product? eBelow are several DNA sequences that are mutated compared with the wild-type sequence. Eachis a section of a DNA molecule that has separated in preparation for transcription, so you are onlyseeing the template strand. For each mutated DNA sequence, translate and record the resultingamino acid sequence. What type of mutation is each? Wild-type sequence: 3’-T A C T G A C T G A C G A T C-5’ Mutated DNA Template Strand #1: 3’-T A C T G T C T G A C G A T C-5’Amino acid sequence of peptide:Type of mutation: Mutated DNA Template Strand #2: 3’-T A C G G A C T G A C G A T C-5’Amino acid sequence of peptide:Type of mutation: Mutated DNA Template Strand #3: 3’-T A C T G A C T G A C T A T C-5’Amino acid sequence of peptide:Type of mutation: Mutated DNA Template Strand #4: 3’-T A C G A C T G A C T A T C-5’Amino acid sequence of peptide:Type of mutation:5' UGG CAA UCC UAC GAU 3' - 1. Here is the MRNA sequence from a section of a gene (it is the middle of the sequence, so it has no AUG). What is the template sequence of this gene? - 2. Are any of these codons in the MRNA non-degenerate? If so, indicate which one. e 3. 4 a) Translate this mRNA section. Give the 3 letter codes for the amino acids. b) Indicate on the peptide which is the C terminus and which is the N terminus. e 4. Is it possible for a single base pair substitution to cause a truncation in this peptide? If so, e explain how. e 5. Write out the sequence of the anticodon in the tRNA that would bind to the fourth codon in the e MRNA. e 6. Write out a possible miRNA that could regulate the expression of this gene