The starting concentration of the lambda DNA is usually 250 ng/μl. Biology 6 B DNA Restriction Digests, Ligations, & Electrophoresis Here's how much DNA you should use for each reaction: Uncut: 0.2 μg DNA (A small amount because it will all be in one band on the gel; if there's too much, the band will be smeared.) Convert to μl: EcoRl-cut: 1.0 μg DNA. Convert to μul: HindIII-cut: 3.0 μg DNA. (A larger amount because you're going to save some for later.) Convert to μl: EcoRI & HindIII-cut: 1.0 μg DNA. Convert to μl:

The starting concentration of the lambda DNA is usually 250 ng/μl. Biology 6 B DNA Restriction Digests, Ligations, & Electrophoresis Here's how much DNA you should use for each reaction: Uncut: 0.2 μg DNA (A small amount because it will all be in one band on the gel; if there's too much, the band will be smeared.) Convert to μl: EcoRl-cut: 1.0 μg DNA. Convert to μul: HindIII-cut: 3.0 μg DNA. (A larger amount because you're going to save some for later.) Convert to μl: EcoRI & HindIII-cut: 1.0 μg DNA. Convert to μl:

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Similar questions

Why is the company Qiagen has more refined DNA extraction steps than a normal Strawberry DNA extraction practical? Summary of Qiagen DNA extraction steps Add ATL buffer and grind with sample. Add 20 microliters of enzyme Proteinase K to degrade protein into a 1.5-2ml microcentrifuge tube. Add 200 microlitres AL lysis buffer, and mix by vortexing for 5–10 seconds, which breaks cell membrane allowing DNA to be released. Incubate the sample at 56 degrees for 10 minutes. Mix the cell lysate with 200 microlitres ethanol by pipetting it at the side of the microcentrifuge wall so DNA precipitates. The DNA forms a white layer and the remaining liquid is discarded. Pipet the mixture into DNeasy Mini spin column placed in a 2 ml collection tube. Centrifuge for a minute at 8000 rpm. Place the mini spin column into a 2 ml collection tube, add 500 µl Buffer AW1, and centrifuge for 1 min at 8000 rpm. Then add it to a new 2 ml collection tube (provided), add 500 µl Buffer AW1, and centrifuge for 1…
#2 EcoRI --- 5’ G ↓AATTC 3’ 5’ ACG ACGTATTAGAATTCTTA TCCGCCGCCGGAATTCT CATCA 3’ 3’ TGC TGCATAATCTTAAGAATAGGCGGCGGCCTTAAGAGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:
Restriction digestion and Gel electrophoresis: A single strand of a double-stranded DNA sequence is shown below. Draw a complementary DNA strand and show the restriction digestion pattern of the double-stranded DNA with BamHI and Pst1. Show the separation pattern of the undigested and the digested DNA on your agarose gel. Label the gel appropriately. 5’ – CGAGCATTTGGATCCTGTGCAATCTGCAGTGCGAT – 3’
Electrophoresis data: Measure the distance (in millimeters) that each fragment traveled from the well and record it in the tabie. Estimate its size, in base pairs, by comparing its position to the Hindll lambda DNA markers. Remember: some lanes will have fewer than 6 fragments. H = Hindll Largest fragment first P Pstl E = EcoRI L = lambda DNA- no restriction digest restriction digest restriction digest of lambda DNA M = DNA marker of lambda DNA enzyme of lambda DNA Estmated base pairs Distance in mm Estimated base pairs Distance in mm Estimated base pa rs Distance inmm Estimated base pairs Dislance Distance in mm Actual base pairs 5 mm 58 mm 54 nm 26.5m 23.130 49m Band 1 69 mm 32. 96 Mm Band 2 9.416 39 hm 120mm 87 mM Band 3 6.557 41 mm 127m 1.00mm Band 4 4.361 1.08m Band 5 2,322 1482m 65mm 2,027 Band 6 Step 3. Now using the standard curve you created in the pre-lab exercises and the distances you measured above, predict the sizes of each fragment based on the distances traveled by…
#4 BamI --- 5’ CCTAG ↓G 3’ 5’ ACGCCTAGGACGTATTATCCTAGGTAT CCGCCGCCGT CATCA 3’ 3’ TGCGGATCCTGCATAATAGGATCCATAGGCGGCGGCAGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:
You digest 4 uL of plasmid DNA that is 50 ng/uL concetration in a total volume of 20 uL. You run 10 uL of the digest on teh gel. You then do a DNA purification protocol with a Zippy prep on the remaining digested DNA. You elute the DNA in a 25 uL. A 2 uL ssample has the concentration of 2 ng/uL. What is the DNA yield? YIELD = How much dna came out of the column/how much DNA was loaded onto the columnRemember to subtract amount of DNA run on gel from total digested DNA to get hw much DNA was loaded onto the columnAmount that came out of the column equals the volume of the eluted DNA times the concentration of the purified DNA
Question Image hown bele nallest? Q. A gel from gel electrophoresis is shown below. Which DNA fragment is the smallest? B. Direction of Travel
You digest 4 uL of plasmid DNA that is 50 ng/uL concetration in a total volume of 20 uL. You run 10 uL of the digest on teh gel. You then do a DNA purification protocol with a Zippy prep on the remaining digested DNA. You elute the DNA in a 25 uL. A 2 uL ssample has the concentration of 2 ng/uL. What is the DNA yield?
2. Restriction Enzyme Mapping - use any resources to assist you including the hints below. A circular plasmid molecule (12,000 total base pairs in size) was cut with a series of restriction enzymes and the digestions were size fractionated by agarose gel electrophoresis. Some digestions involved just one enzyme (single digest), some combinations of two enzymes (double digests), and one utilized all three enzymes (triple digest). Agarose gel electrophoresis of the digestions produced bands of the following sizes. Enzyme EcoRI Hindi!! Pstl EcoRI and Hindill EcoRI and Psti Hindill and Pstl EcoRI, Hindill, and Pst I Bands of the Agarose Gel (size in base pairs) 2300 and 9700 4000 and 8000 12,000 800, 1500, 2500, and 7200 2300, 3200, and 6500 4000 800, 1500, 2500, 3200, and 4000 I Draw a plasmid map showing the location of the restriction enzyme sites relative to each other for each map. Include all 7 maps in your answer.
U have the plasmid pUC18/19, which is a circular plasmid that consists of 2686 bp. What would the number of and length of the fragments be if you cut the plasmid with the following restriction enzymes or combination of enzymes? Give a schematic representation of the digestions. PscI & GsuI ______________________________________________________________ ScaI, PdmI & BsaXI ______________________________________________________________ ScaI, SspI & EheI ______________________________________________________________
ull rain LTE 11:53 © 1 0 A 10% Done #1 Mol Bio Restriction Analysi... Complete the following problems. Restriction enzymes (REs), which cut D NA at specific sequences, are classic tools in molecular biology. Because of their specificity in cutting DNA, REs can be used to "map" DNA sequences by analyzing the fragments generated upon restriction digest, as in the example shown in Figure 1. Your task is to study the circular plasmid, pMBBS, through restriction digests. You subjected the PMBBS plasmid to complete digestion by different combinations of three REs (EcoRI, BamHI, and Xhol), and analyzed the results on an agarose gel, shown below. Using the data you can glean from this gel, answer the questions that follow. EcoRI BamHI Xhol DNA size ladder 600 bp 500 bp 400 bp 300 bp 200 bp 100 bp VC 100bp Plus DNA ladder from Vivantis Technologies *The same total amount of DNA was loaded in each lane. 1. What is the total size of the PMBBS plasmid in bp? Answer: bp 2. How many cut sites on the…
Kpnl 4. Plasmid Z has a size of 7 kb, and the map shows Kpnl (K) and Pstl (P) cut sites relative to each other. This plasmid was digested with three different restriction enzymes 2000 bp 3500 bp Kpnl (K), Pstl (P) and Bgll (B) either alone or in combination and the samples run on an agarose gel as shown below. Where does Bgll (B) cut this plasmid ? Does the plasmid have one recognition site or two for Bg|l? Describe the Bgll cut site in this plasmid relative to the Kpnl cut Plasmid Z -7 kb Pstl site. How many bases to the left or right of the Kpnl cut site would you observe the Bgll cut site. Explain briefly. 1500 bp Pstl Ladder Kpni Psti K/P Bgl K/B KPB 7000 bp 7000 bp 5600 bp 5500 bp 4900 bp 3500 bp 2000 bp 1500 bp 1500 bp 1500 bp 1400 bp 600 bp %3D