Terminator Transcription stops ||||| 5' Transcription continues Antiterminator 4. pt) Among the structurally simplest riboswitches are the two so-called purine riboswitches, one of which responds to guanine, and the other to adenine. The accompanying diagram shows a guanine riboswitch. Base pairing between free guanine (blue) and a particular cytosine residue within the aptamer determines the riboswitch conformation. a) What condition in the cellular environment would favor each of the riboswitch configurations?

Terminator Transcription stops ||||| 5' Transcription continues Antiterminator 4. pt) Among the structurally simplest riboswitches are the two so-called purine riboswitches, one of which responds to guanine, and the other to adenine. The accompanying diagram shows a guanine riboswitch. Base pairing between free guanine (blue) and a particular cytosine residue within the aptamer determines the riboswitch conformation. a) What condition in the cellular environment would favor each of the riboswitch configurations?

Name: 5TerminatorTranscriptionstops5'TranscriptioncontinuesAntiterminator4.
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: 5TerminatorTranscriptionstops5'TranscriptioncontinuesAntiterminator4. pt) Among the structurally simplestriboswitches are the two so-called purineriboswitches, one of which responds toguanine, and the other to adenine. Theaccompanying diagram shows

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter29: Transcription And The Regulation Of Gene Expression

Section: Chapter Questions

Problem 3P: Substrate Binding by RNA Polymerase RNA polymerase has t binding sites for ribonucleoside...

See similar textbooks

Similar questions

Transcription AttenuationHow would transcriptionof the E. coli trp operon be affected by the following manipulations of the leader region of the trp mRNA?(a) Increasing the distance (number of bases) betweenthe leader peptide gene and sequence 2(b) Increasing the distance between sequences 2 and 3(c) Removing sequence 4(d) Changing the two Trp codons in the leader peptidegene to His codons(e) Eliminating the ribosome-binding site for the genethat encodes the leader peptide(f) Changing several nucleotides in sequence 3 so thatit can base-pair with sequence 4 but not with sequence 2
BM4_DNA AND PROTEIN S X /1FAIPQLSDP_g5B-629FSHNpGnTMIEppLS4A71zBd4vcUBqNUILubXONw/formResponse 4. What is the nitrogen base pair of Adenine in transcription? O Cytosine O Uracil O guanine O thymine 5. The central dogma of Molecular Biology states that There are four nitrogen bases in DNA, two purines (adenine and guanine) and two pyrimidines (cytosine and thymine). Which process is not included in the central dogma? duplication transcription translation O translocation Leadple
Substrate Binding by RNA Polymerase RNA polymerase has t binding sites for ribonucleoside triphosphates: the initiation site and the elongation site. The initiation site has a greater Km for NTPs than the elongation site. Suggest what possible significance this fact might have for the control of transcription in cells.
34The crystal structure has been determined for the complete 12-subunit yeast RNA polymerase II bound to a transcription bubble and product RNA. Yesorno 35 ( ) can be used to purify transcription activator proteins 36A mutation that adds or deletes a base pair in the open reading frame and is termed a ( ) mutation.
SARS E You have generated several random mutations in this region. One of them is - 5'-AAUUACCUAUAGAUUGUUU-3' What may be the mutant protein sequence Enter the single letter code for the amino acids. For a stop codon (if any) enter: STOP And fill subsequent blanks with: N/A For example: if you the sequence you need to enter is: M*, enter M N/A N/A N/A N/A
in m 5'- 3'- Shown below is a schematic diagram illustrating a very short gene with 3000 bp region of an unknown Escherichia coli genome. (Note: Transcription starts at Transcription Start Site (TSS).) TSS -3' -5' +1 (i) Name the specific regions that can be recognized by sigma factor and indicate the locations in the diagram above. (ii) How does Sigma factor trigger the initiation of transcription?
GTTTTCACTGGCGAGCGTCATCTTCCTACT 8. What is the function (e.g. transcriptional regulation, transmembrane signaling, kinase, protease, etc.) of the protein(s) encoded by the gene.
94In the arrested state (7-14 nucleotides) of elongation, ( ) is required to reactivate transcription. 95C. elegans has about 19,000 genes, a significant number of which are organized into operons. Yesorno 96Transcription activator proteins have at least two independently folding domains: 1. DNA binding domain and 2.
Biol 1406-Lec 17 - Gene Exp X acconline.austincc.edu/ultra/courses/_891351_1/cl/outline Question completion Status. Blackboard Learn Which of the following stater X 9. Which of the following statements about transcription is not true? In both prokaryotes and eukaryotes, pre-mRNA is modified after transcription by adding a 5' cap and a 3' poly-A tail and splicing out introns leaving coding exons. Paraphrasing Tool - QuillBot Your disk is almos Save space by optir O During transcription only one DNA strand called the template strand is read and rewritten by RNA polymerase with the template strand read in the 3' to 5' direction and the mRNA transcript synthesized in the 5' to 3' direction. O During initiation of transcription, RNA polymerase binds to the promoter region in the DNA, unwinds the DNA and binds together RNA nucleotides complementary to the template DNA strand. O During initiation of eukaryotic transcription, the promoter region contains a TATA box in which transcription…
Consider the Rho-dependent terminator sequence 5’CCCAGCCCGCCUAAUGAGCGGCCUUUUUUUU-3’. What affect would a point mutation at any one of the bolded and underlined nucleotides disrupt termination of transcription? Group of answer choices 1.Mutation in one of these nucleotides would disrupt base pairing, but not affect the formation of the hairpin and termination proceeds. 2.Mutation in one of these nucleotides would have no affect on base pairing, so the termination hairpin is formed and termination proceeds. 3.Mutation in one of these nucleotides would not disrupt base pairing, but would prevent the formation of the hairpin and disrupt termination. 4.Mutation in one of these nucleotides would disrupt base pairing, preventing the formation of the hairpin and disrupting termination.
Consider the structure of Cro repressor protein from bacteriophage lambda E. It is a DNA binding protein, and like many sequence- specific DNA binding proteins, it must function as a homodimer Ex. Notice the mutual docking of a phenylalanine residue from each subunit into a hydrophobic pocket of the partner subunit. These hydrophobic interactions are required for dimerization. The noncovalent interactions highlighted in yellow are also required for dimerization. These interactions represent examples of: Osecondary structure O tertiary structure O quaternary structure O secondary AND quaternary structure Ⓒ tertiary AND quaternary structure
Please help with all parts of A, B, C, D 2. You are studying the function of a messenger RNA named Genetixrox and want to label themRNA with a radioactive atom. Assume the mRNA is long and contains all four standardRNA bases. Assume that the cell cannot convert ribonucleotides to deoxyribonucleotides (orvice versa).A. Will you generate radioactive Genetixrox mRNA with 3H-threonine? Threonine is an aminoacid. Answer yes or no, and provide a one sentence rationale.B. Will you generate radioactive Genetixrox mRNA with 3H-adenosine triphosphate? Answeryes or no, and provide a one sentence rationale.C. Will you generate radioactive Genetixrox mRNA with 3H-deoxyadenosine triphosphate?Answer yes or no, and provide a one sentence rationale.D. Will you generate radioactive Genetixrox mRNA 12C-with adenosine triphosphate? Answeryes or no, and provide a one sentence rationale