+++ 1667 abc 1651 ++ C 260 ab+ 295 a++ 521 +bc 548 +b+ 640 a+c 657

THE MOLECULAR GENETICS OF SICKLE CELL ANEMIA The following is the base sequence of DNA that codes for first eight amino acids of the B chain of hemoglobin. The B chain of hemoglobin contains a total of 147 amino acids so this is a small part of the entire gene. DNA Template Strand: TACCACGTGGACTGAGGACTCCTC 1. What is the minimum number of DNA nucleotides in this whole gene? 2. What is the sequence of bases on the strand of DNA that is complementary to the template strand? 3. What mRNA will be formed from the template strand of DNA? 4. What amino acids will this mRNA code for? 5. If the 20th base in the template strand of the DNA is changed from T to A, rewrite the new template strand below. 6. When the template strand of the DNA is changed, this is referred to as a mutation. What kind of mutation is this? 8. 7. What mRNA will be formed from the mutated template strand of DNA? What amino acids will this new mRNA from the mutated template strand code for? 9. Are these new amino acids the…

Assuming that the mean size of the human sau3AI partially digested fragments clones is 3kb, calculate the proportion of the human genome represented in all libraries prepared by the class. Use a value of 3,000,000kb for the size of the human genome. You also need to know that the whole 'class' generated 3,514 white colonies on plate 2.

Assume 2x108 reads of 75 bps long are obtained from a next-generation sequencing experiment to sequence a human genome. Suppose the length of the human genome is 3x109 bps. What is the depth (i.e., coverage) of the sequencing?

When stained with Giemsa (G-Banding staining), the centromere will be stained:   Question 28 options:   more robustly (dark band)   less robustly (light band)

The haploid human genome consists of approximately 3.2 × 109 bp (or 6.4 × 109 bp per diploid genome). Assuming that DNA is B-DNA, calculate the total length of a single cell’s DNA.

Traditional Sanger sequencing has largely been replaced in recent years by next-generation and third-generation sequencing approaches. Describe advantages of these sequencing methods over first-generation Sanger sequencing.

Give typed full explanation  You are studying three linked genes in snapdragons. The flower color locus is in the center. There are 13.8 cM between the flower color locus and the plant height locus. There are 14.5 cM between the flower color locus and the leaf type locus. The coefficient of coincidence is 0.8. Pure-breeding tall, red-flowered plants with fuzzy leaves were crossed to pure-breeding dwarf, blue-flowered plants with smooth leaves. The F1 were testcrossed. Calculate the proportion of the testcross progeny that are expected to be dwarf with red flowers. Round properly to 4 decimal digits.

a- What is De Bruijn graph, and why it is used? b- Given the folowing string ACGCGTCG. draw De Bruijn graph where K-3

What is the Lineweaver-Burk plot and what does it tell us?