Animation 12.1: This table shows results from allele specific oligonucleotide hybridization analyses conducted on three different patients. The analyses all used the same probes constructed to test for the presence of a mutant gene. A plus sign (+) indicates hybridization occurred and a negative sign (-) indicates no hybridization occurred. Patient #1 Patient #2 Patient #3 Probe for nomal +] allele Probe for mutant allele Which patient(s) is/are homozygous for the mutation and which patient(s) is/are heterozygous for the mutation? O Patients 2 and #3 are homozygous and Patient #1 is heterozygous for the mutation. O Patient 22 is homozygous and Patient #1 is heterozygous for the mutation. O Patient #1 is homozygous and Patients #2 and #3 are heterozygous for the mutation. O Patient #1 is homozygous and Patient #2 is heterozygous for the mutation.

What is 15q?

What is Spectral Karyotyping.?

What are streak patterns designed to do? What are the 4 steps in the quadrant streak method using a loop?

solve all 3 questions and typed answer please

What is a notch 3 gene mutation test?

what are marker chromosomes and why can spectral karyotyping detect them?

this is what i have said about this image so far, what else can be said aswell including the raw count column. "   Interpreting the results of an RNA-Seq analysis is pivotal in understanding the underlying genetic mechanisms of diseases such as breast cancer. In this analysis, Figure 1 provides comprehensive data on differentially expressed genes associated with breast cancer. By delving into the provided information, we can gain valuable insights into the molecular landscape of this disease. First focus is on the gene with the highest fold change, EYA4, situated on chromosome 6. With a staggering fold change of 3604.4176, EYA4 exhibits an unprecedented level of overexpression in cancerous cells compared to normal cells. This profound alteration suggests a pivotal role for EYA4 in breast cancer pathogenesis. The log2 fold change of 11.81555 further emphasizes the magnitude of this difference in gene expression. Statistical significance is evident, with an exceptionally low p-value of…

Can you further explain the second primer how we get that and possibly draw it out? GTCAAATTACATTACACATAA

An interrupted mating study is carried out on Hfr strains 1, 2, and 3. After conjugation is established, a small sample of the mixture is collected every minute for 20 minutes to determine the distance between the genes on the chromosome. Times of entry for each of the three Hfr strains studied in the interrupted mating are provided in parenthesis. The total duration of conjugation (in minutes) is given for each transferred gene. Hfr Strain Genes Transferred Hfr 1 oriT(0)  met(2)   ala(8)  lac(13)  gal(17) Hfr 2 oriT(0)  met(2) leu(7)  thr(10)  azi(17) Hfr 3 oriT (0)  gal(3)  pro(8)  trp(14)  azi(19) Hfr 4 oriT leu met ala lac Hfr 5 oriT trp azi thr leu a. Use the data to construct a circular map of the bacterium.