Animation 12.1: This table shows results from allele specific oligonucleotide hybridization analyses conducted on three different patients. The analyses all used the same probes constructed to test for the presence of a mutant gene. A plus sign (+) indicates hybridization occurred and a negative sign (-) indicates no hybridization occurred. Patient #1 Patient #2 Patient #3 Probe for nomal +] allele Probe for mutant allele Which patient(s) is/are homozygous for the mutation and which patient(s) is/are heterozygous for the mutation? O Patients 2 and #3 are homozygous and Patient #1 is heterozygous for the mutation. O Patient 22 is homozygous and Patient #1 is heterozygous for the mutation. O Patient #1 is homozygous and Patients #2 and #3 are heterozygous for the mutation. O Patient #1 is homozygous and Patient #2 is heterozygous for the mutation.

What is Spectral Karyotyping.?

What is a notch 3 gene mutation test?

this is what i have said about this image so far, what else can be said aswell including the raw count column. "   Interpreting the results of an RNA-Seq analysis is pivotal in understanding the underlying genetic mechanisms of diseases such as breast cancer. In this analysis, Figure 1 provides comprehensive data on differentially expressed genes associated with breast cancer. By delving into the provided information, we can gain valuable insights into the molecular landscape of this disease. First focus is on the gene with the highest fold change, EYA4, situated on chromosome 6. With a staggering fold change of 3604.4176, EYA4 exhibits an unprecedented level of overexpression in cancerous cells compared to normal cells. This profound alteration suggests a pivotal role for EYA4 in breast cancer pathogenesis. The log2 fold change of 11.81555 further emphasizes the magnitude of this difference in gene expression. Statistical significance is evident, with an exceptionally low p-value of…

An interrupted mating study is carried out on Hfr strains 1, 2, and 3. After conjugation is established, a small sample of the mixture is collected every minute for 20 minutes to determine the distance between the genes on the chromosome. Times of entry for each of the three Hfr strains studied in the interrupted mating are provided in parenthesis. The total duration of conjugation (in minutes) is given for each transferred gene. Hfr Strain Genes Transferred Hfr 1 oriT(0)  met(2)   ala(8)  lac(13)  gal(17) Hfr 2 oriT(0)  met(2) leu(7)  thr(10)  azi(17) Hfr 3 oriT (0)  gal(3)  pro(8)  trp(14)  azi(19) Hfr 4 oriT leu met ala lac Hfr 5 oriT trp azi thr leu a. Use the data to construct a circular map of the bacterium.

Compared to the normal A allele, the disease-causing allele in sickle cell anemia (S allele) is missing an MstII restriction site. On a Southern blot of genomic DNA cut with MstII and hybridized with the probe shown on the diagram below, a person with sickle anemia, carrying two S alleles, will show Choose an answer below: a single band at 1.1 kb. a single band at 1.3 kb. a single band at 0.2 kb. one band at 0.2 and one at 1.3 kb. one band at 1.1 and one at 1.3 kb.

Why are there multiple results returned when you input a sequence into BLAT or BLAST? How do you know which is most relevant? Does that make the others irrelevant?

design a molecular beacon probe (15-20 NT long) for qPCR of the gene   5`- AACTATATTTACACTTGTCACTACTTTCGGTTATGGTGTTCAATCTTTGCGAGATACCCAGATCATATGAAACAGCATGACTTTTTCAAGAGTGCCATGCCTGAAGGTTATGTACAGGAAAGTTACATTCTTGGACACAAATTGGAATACAACT-3`

7:12 What is not true for Sequence tagged site (STS) markers: O cannot be mapped by fluorescence in situ hybridization (FISH) O subset of STS markers are known as expressed sequence tag (EST) markers O can readily be screened by a PCR assay O short DNA sequences that occur at a unique location in the genome

2c) If the whole potoroo genome is 4.2 x 10' bp, and the highlyrepetitive DNA in the potoroo genome is composed entirely ofcopies of the sequence 5'AAGACT' and its complement, howmany copies of this sequence are present in the potoroogenome?