10. Transcription is 11. Translation is 12. Which feature distinguishes the sugar from DNA and RNA?_ 13. Which RNA carries an amino acid during protein synthesis? 14. During translation are attached to the end_tRNA unit. 15. The sequence of one strand of double stranded DNA is 5'-AGCGTCG-3'. The sequence of the complementary strand is (Using the biochemistry convention 5'→ 3' 16. In the genetic code how many nitrogen bases (in a codon) are required to add one amino acid during translation?

10. Transcription is 11. Translation is 12. Which feature distinguishes the sugar from DNA and RNA?_ 13. Which RNA carries an amino acid during protein synthesis? 14. During translation are attached to the end_tRNA unit. 15. The sequence of one strand of double stranded DNA is 5'-AGCGTCG-3'. The sequence of the complementary strand is (Using the biochemistry convention 5'→ 3' 16. In the genetic code how many nitrogen bases (in a codon) are required to add one amino acid during translation?

Name: do all typed answer plz very easy 10. Transcription is11. Translation
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: do all typed answer plz very easy 10. Transcription is11. Translation is12. Which feature distinguishes the sugar from DNA and RNA?_13. Which RNA carries an amino acid during protein synthesis?14. During translationare attached to the_end_tRNA unit.1

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 17QP: Given the following mRNA, write the double-stranded DNA segment that served as the template....

See similar textbooks

Related questions

Q: Can I ask for the references? Thanks

A: The question pertains to the concept of genetic mosaicism, which is a phenomenon that occurs when…

Q: If it-----rain, we'll go to the park doesn't won't didn't wouldn't Fifty dollars were- * .from my…

A: A verb is a word that exhibits an action, occurrence, and state of being. Verbs have 3 tenses;…

Q: what us this tissue? nervous, muscle, epithelial of connective cell?

A: Nervous tissue: This is a kind of tissue involved in control and coordination and is found in the…

Q: Stop waiting to find a good person instead of trying to be a better person that attracts good people…

A: The secret to drawing good people into our lives is to invest in personal development and always aim…

Q: Hello, I am doing an assigmentn about San Diego but foirst I need to list resources available to the…

A: Detailed explanation: It is imperative to include every possible emergency and response mechanism in…

Q: define disparagement, and state why it is a problem that is to be avoided in health care practice…

A: Disparagement is to act of speaking about something and someone in a way which shows that do not…

Q: Please help urgently with the complete answer of this question asap

A: Proteins are biomolecules are made of amino acid monomers. Amino acids are joined together by…

Q: Please fill in the blank in the picture, thank you

A: Skeletal muscles are characterized by their voluntary nature. These are striated muscles that are…

Q: This was previously rejected due to not including all parts of the question. I've added all parts in…

A: Since you have posted a question with multiple sub-parts, we will solve first three subparts for…

Q: True or False Determine if the statement is true or false. If false, replace the word(s) in bold…

A: Cell is the structural and functional unit of life discovered by "Robert Hook" (1665) from cork…

Concept explainers

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.

Topic Video

Question

do all typed answer plz very easy

10. Transcription is
11. Translation is
12. Which feature distinguishes the sugar from DNA and RNA?_
13. Which RNA carries an amino acid during protein synthesis?
14. During translation
are attached to the
_end_tRNA unit.
15. The sequence of one strand of double stranded DNA is 5'-AGCGTCG-3'. The sequence of the complementary
strand is
(Using the biochemistry convention 5'→ 3'
16. In the genetic code how many nitrogen bases (in a codon) are required to add one amino acid during
translation?

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps with 1 images

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

A scientist introduces a mutation that makes the 60S ribosomal subunit nonfunctional in a human cell line. What would be the predicted effect on translation? Translation stalls after the initiation AUG codon is identified The ribosome cannot catalyze the formation of peptide bonds between the tRNAs in the A and P sites The ribosome cannot interact with mRNAs tRNAs cannot exit the E site of the ribosome.
Which of the following is not made out of RNA? the carriers that shuffle amino acids to a growing polypeptide strand the ribosome the messenger molecule that provides the code for protein synthesis the intron
The AUC and AUA codons in mRNA both specify isoleucine. What feature of the genetic code explains this? complementarity nonsense codons universality degeneracy
Given the following mRNA, write the double-stranded DNA segment that served as the template. Indicate both the 5 and the 3 ends of both DNA strands. Also write out the tRNA anticodons and the amino acid sequence of the protein encoded by the mRNA message. DNA: mRNA: 5-CCGCAUGUUCAGUGGGCGUAAACACUGA-3 protein: tRNA:
1. Given the piece of MRNA: 5'-CCUGCAGUAUGAAACGCCUGGUAGAAGGUGGGAAGUGGUGCGCC-3' 1. Predict the DNA strand sequence from which it was transcribe 2. List the complementary non-coding DNA Sequence 3. List the Amino acid Sequence of the protein coded for. Use the Genetic Code 2. Below is a short segment of a DNA molecule. Translate the DNA codon into MRNA. 5'- TACCATGAGAATTGTGG TCACCTTTTT-3' 3'- ATGGTACTCTTAACACCAGTGGAAAA A-5' MRNA Sequence Amino Acid Sequence
8. Below is a double stranded DNA: ATATGTGGTCTCGG TCCGTTAGGCAAT TATACACCAGAGCCAGGCAATCCGTTA 8.1. Which strand functions as the transcription template, the top one or the bottom one? Explain your reasoning What is the MRNA transcript and polypeptide from this strand? In the space below, copy the DNA strand that is transcribed, and write the MRNA transcript. 8.2. 8.3. Identify the polypeptide chain below it. Align the MRNA and polypeptide so that it is clear which DNA bases they came from.
1. Create a DNA sequence with eighteen nucleotides. Indicate its 3’ on the left and 5’ on the right since that’s the template strand you will need in the next question to transcribe the mRNA. 2. Transcribe the DNA sequence above and separate the triplets into codons. Indicate 5’ and 3’ in the correct location on the strand. (Don’t worry about splicing- assume that the pre- mRNA is the same as the mature mRNA sequence) 3. Look at the genetic code, and indicate which amino acid is coded for by the codons in the above mRNA. 4. ANSWER BELOW QUESTIONS: A. First write the original DNA strand. Indicate where the substitution was by either circling it or writing it in a different color. Then write the mutated DNA sequence with the point mutation (aka substitution) wherever you choose for it to be. Again, circle it or write it in a different color. Do the same for the transcribed mRNA. Repeat the directions for 2 and 3 for this new DNA stand. (i.e., include the mRNA and translated protein…
9
1. What is the nucleotide sequence of the complementary strand of the DNA molecule: 5’-AATGCGATCTTCAT-3’?2. What is the nucleotide sequence of the mRNA transcribed from the template DNA strand: 3’-GCTACAAAAAGTCCATAATCGC-5’? Indicate the 5’ and 3’ ends.3. If the mRNA sequence you obtained in question 2 were to be translated, what would be the sequence of amino acids? Indicate the N-terminal and C-terminal amino acids.
Number 7
DNA Leading strand: 5' AAA ATA | CGC TTT| TTA ATT | AAC CCC GGG 3' A I B IC| D Exons: A, C, D Introns: B 1. What is the structure of hnRNA transcribed from this template? 2. What is the structure of the MRNA obtained by splicing the hnRNA? 3. What will be the polypeptide sequence to be synthesized using this mRNA?
11. The segment of DNA below contains three exons and two introns. The length of each section is as follows: Exon 1: 90 base pairs Exon 2: 110 base pairs Exon 3: 70 base pairs Intron 1: 180 base pairs Intron 2: 120 base pairs Initiation Site Intron 1 Promoter Exon 1 Intron2 Exon 3 Termination Site A. How long will the coding region of the processed mRNA transcript be? (Remember that stop codons are indeed transcribed into mRNA.) B. How many amino acids will be included in the translated protein? (Careful!) X PolyA site Exon 2