1. If there were only two alleles of TAS2R38 (AVI and PAV) in the human population, what are the possible allelic combinations in diploid cells? 2. For the sake of simplicity, assume that only the amino acids Pro, Ala and Val make up the functioning active site pocket within the taste receptor TAS2R38. Using your knowledge of amino acid properties, describe the environment of the active site. Is it surprising that changing these amino acids to Ala, Val and Iso, respectively, inhibits the receptor from binding PTC?

1. If there were only two alleles of TAS2R38 (AVI and PAV) in the human population, what are the possible allelic combinations in diploid cells? 2. For the sake of simplicity, assume that only the amino acids Pro, Ala and Val make up the functioning active site pocket within the taste receptor TAS2R38. Using your knowledge of amino acid properties, describe the environment of the active site. Is it surprising that changing these amino acids to Ala, Val and Iso, respectively, inhibits the receptor from binding PTC?

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Similar questions

The pathway for arginine biosynthesis in Neurospora crassa involves several enzymes that produce a series of intermediates as shown. O O O O ornithine citrulline ARG-E arginosuccinate arginine N-acetylornithine arginine You did a cross between ARG-E ARG-H* and ARG-E* ARG-H¯¯ Neurospora strains and identified an Arg- strain from an NPD tetrad. (Assume that Neurospora forms tetrads in the same way yeast do.) Which compound would rescue growth of this Arg- spore? N-aceltylornithine ARG-F ornithine citrulline ARG-G ARG-H → argininosuccinate
1) Using the diagram below, sketch in the pattern of bands you would expect to see after digesting the DNA of the TT, Tt and tt genotypes of the TAS2R38 gene. Use the Base Pair Standards on the left of the diagram as a reference in drawing the positions of the bands. Base Pair TASTER GENO TYPE Standards (Base Pairs) TT Tt tt 500 400 300 200 100 50
. If you wanted to study olfactory signaling, what is another gene you could mutate and what would you predict to show? What experiment would you do to determine the effect of the mutation references -Arrestin2-Mediated Internalization of Mammalian Odorant Receptors Anastasia Mashukova,1 Marc Spehr,2 Hanns Hatt,1 and Eva M. Neuhaus11Cell Physiology and 2Emmy Noether Research Group, Cell Physiology, Ruhr-Universitaet Bochum, 44780 Bochum, Germany
Gamete Production: in the following examples please list the possible gametes produced 1) In humans, sickle cell anemia is a disease caused by a mutation of a single gene that codes for an important protein. The allele for the normal protein is dominant (S) to the one that causes sickle cell anemia. a. What gametes would be produced by an individual who suffers from sickle cell anemia produce? b. What gamester would be produce by an individual that is a carrier of the sickle cell trait?
9. please answer this . very important
1. ALT is not used as a hepatocellular damage marker in cattle. Explain why.
2. Below, recognition sites of two of these enzymes, Pstl and Nsil, are given 5'... CTGC AG. 3... GACGTC...5 3 Pstl recognition and cleavage site 5... ATGCAT 3'... TACGTA ... 5' 3' ... Nsil recognition and cleavage site a. Does cleavage by Pstl result in a 5' or 3' overhang? What is the sequence of this overhang? b. Does cleavage by Nsil result in a 5' or 3' overhang? What is the sequence of this overhang? c. Suppose you have a cloning vector that contains a Pstl recognition site and you also have foreign DNA that was cut with Nsil. Can this DNA be ligated into the Pstl site of the vector, and if so, explain its reason and draw the new ligation site. d. Can the new ligated DNA segment sequence be cut from the vector with Pstl or Nsil ? What potential problems do you see?
4.) Fully explain the role Gal3 has in the expression of galactose inducible (gal) genes.
22. heterozygous mice for the Sd gene are shown to have relatively shorter or lack a tail true or false
1. Cancer genetics Breast cancers can be divided into several classes. One type of breast cancer, classified as HER2 positive ("HER2+"), represents 15-20% of breast cancers. Most HER2+ cancers arise due to amplification of the HER2 gene (without any mutation of the HER2 protein coding region). HER2 amplification is also associated with several other types of cancer (e.g. stomach cancer). Would the HER2 gene be considered a proto-oncogene or a tumor suppressor gene? Justify your answer based on the function of the HER2 protein (look it up). b. How does amplification of HER2 promote cancer? c. Some HER2+ cancers have become resistant to the antibody drug. These cells were found to have mutations of the PTEN gene (look for information about the PTEN gene). Are these likely to be recessive loss of function mutations or dominant gain of function mutations of PTEN? Justify your answer, relating PTEN mutations to drug resistance.
Fig 2 shows gastric organoids cultured from a TffCre; XYZI/fl mouse. Ki67 has been used to identify proliferating cells (green). Tamoxifen indicates exposure to tamoxifen to induce recombination of the TffCre. No Tamoxifen Ki-67 3. What is the consequence of deleting XYZ in gastric organoids, and does this suggest it is an oncogene or a tumour suppressor? Explain your reasoning. DX Equation Editor 4. IWP inhibits the secretion of Wnt ligands from the organoids. Therefore, do Wnt ligands promote or inhibit proliferation of XYZ deficient organoids? Explain your reasoning. X Equation Editor Tamoxifen Q Tamoxifen + IWP A- A I B IU S x, x² Styles Font Size Font Words: 0/250 张 A- A-T BIUS X, x² Styles ▾ Size
7. If you have aligned orthologous gene sequences from an important, conserved gene; there is a different way you can determine reading frame. a. The following sequences of orthologous copies of the insulin receptor gene (INSR) from four species. The sequences are aligned but the reading frame is unknown. What is the reading frame for these sequences? (ie., Does the first complete codon begin at the first, second, or third nucleotide?) Hint: Think about what you know about the nature of mutations, natural selection and the genetic code. 1. Bear CCTGAAGAGCTACCICCGCICCCIGCGGCCGGAGGCTGAGAATAACCCCGGCCGCCCT 2. Human CCTGAAGAGCTACCICCGTICICIGCGGCCAGAGGCTGAGAATAATCCIGGCCGCCCI 3. Chicken CITGAAAAGCTACCIACGCTCICIGAGACCCGACGCIGAGAATAACCCTGGICGICCA 4. Cow CCTGAAGAGTTACCTCCGTTCCCIGCGGCCTGAGGCTGAGAATAACCCCGGCCGCCCT Answer: