4.) Fully explain the role Gal3 has in the expression of galactose inducible (gal) genes.

a. How do bacteria increase the efficiency of gene expression? Is this possible in eukaryotes? b. A mutation in the promoter of Gene K disrupts an enzyme binding site and results in the loss of Gene K expression. Is this change in gene expression likely happening at the transcriptional or the translational level? Explain. c. Propose three different mutations to prevent initiation, elongation, and termination of bacterial transcription, respectively. Explain how/why each mutation would prevent its respective step. (Hint: mutations can be in genes that encode proteins or regulatory DNA sequences)

GTTTTCACTGGCGAGCGTCATCTTCCTACT 8. What is the function (e.g. transcriptional regulation, transmembrane signaling, kinase, protease, etc.) of the protein(s) encoded by the gene.

RNA knockdown has become a powerful tool in the arsenal of methods used to repress gene expression. Briefly describe how gene expression can be knocked down. What effect would introducing siRNAs to TSC1 have on human cells?