Human Anatomy & Physiology (11th Edition)
11th Edition
ISBN: 9780134580999
Author: Elaine N. Marieb, Katja N. Hoehn
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Expert Solution
This question has been solved!
Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.
This is a popular solution
Trending nowThis is a popular solution!
Step by stepSolved in 3 steps with 1 images
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- 2.Fill in the blank with the best answer. If band 3 (6 kB) in lane 5 contains 280 ng of DNA, then band 6 (2.1 kB) must contain mg of DNA. (use scientific notation). Ethidium bromide (use the most scientific term) between the in the DNA; a band that is 60 kB will be than a 40,000 bp band in the same lane; if the 60 kb band contains 0.02 ug of DNA per intense kB, than the band that is 40,000 bp in the same lane will contain ng of DNA, or ng/kB. The chemical structure of ethidium bromide has that make it look like the in DNA.arrow_forward2. Consider the following DNA molecule. Assume this is the DNA sequence of the entire chromosomes. Assume there are no introns. 3' AATTAGCAGATGCATGATGCAATTACTAGCATGTAAGTA 5' 5' TПААТСGTТСТАСGTACTАCGTTAATGATCGTACATTCAT 3' Based on your knowledge of open reading frames, list the amino acid sequences of the possible protein or proteins that could be produced from this DNA sequence. You may use any codon table of your liking to complete the work. a. b. Suppose there was a sister chromatid generated from the chromosome sequence shown above. What would be its DNA sequence (provide the sequence in the space below. Be sure to identify the 5' and 3'ends)?arrow_forward1. Determine the effect of the following mutations on the DNA sequence. In each case, the mutation is described after the sequence (REFER TO THE SUPPLEMENTAL DOCUMENT FOR GUIDANCE TO THIS QUESTION). Adenine nucleotide (A shown in red below) was inserted into the DNA sequence at the position indicated by the arrow). Write out the sequence of the mutated DNA and the protein made from it. What is the effect of this mutation on the protein? (For example, how will the mutation affect the length and sequence of the protein? What about the function of the protein?) A 3' TACATGG'TTGTGCTAATT 5'arrow_forward
- 16. The process of attaching biological functions to DNA sequences is called?arrow_forward4. Discuss and detail reasons why eukaryotic organisms appear to have more DNA than is necessary to code for all the possible proteins they have in their cells. Correlate the functions of DNA as related to proteins in your discussion. Cite specific examples. ience of Genetics society. Cit exar hiqu emploarrow_forward1. Give the different hydrolytic products of : a DNA b. RNA 2. Enumerate the biological functions of DNA and RNA.arrow_forward
- 1. In the sequence grid below, you will fill in all boxes with end polarity, nucleotide, or amino acid as described below. a. The column to the far left identifies the sequence type. Based on the nucleotides given, fill in the words "template" and "coding" (non-template) for the two DNA strands as soon as you figure out which is which. (hint: look at mRNA) b. In the second and last columns, write the polarity of the ends of each sequence (5', 3', N or C). c. The remaining columns represent transcriptional and translational alignments. Fill in all nucleotides, assuming that the template sequences in the table are read from LEFT to RIGHT d. Using the mRNA codon table provided on the next page, determine the polypeptide sequence. This sequence is from the middle of a coding sequence, therefore you do not need a start sequence. T DNA DNA mRNA codon tRNA anticodon polypeptide DNA DNA mRNA codon tRNA anticodon A C polypeptide GLY A C G e. Repeat steps 1a-1d, but now assume that the template…arrow_forward1c) T. aquaticus genomic DNA is 34.3% guanosine nucleotides. What fraction of the DNA is adenosine nucleotides? 1 0.9 0.8 0.7 0.6 0.5 0.4 0.3 0.2 0.1 Fraction of DNAarrow_forward1. Regarding the triple DNA code, which of the following statements is true? • each DNA base encodes three amino acids • there are three genes encoding a protein • each amino acid is encoded by three DNA •bases each triplet encodes several amino acidsarrow_forward
arrow_back_ios
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education