Brock Biology of Microorganisms (15th Edition)
15th Edition
ISBN: 9780134261928
Author: Michael T. Madigan, Kelly S. Bender, Daniel H. Buckley, W. Matthew Sattley, David A. Stahl
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 9.10, Problem 1MQ
- Why is the term “proteome” ambiguous, whereas the term “genome” is not?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Why is genomic information alone insufficient to characterize the proteome?
What is the difference between the genome and the proteome?
What is the proteome? Why is genomic information alone insufficient to characterize the proteome?
Chapter 9 Solutions
Brock Biology of Microorganisms (15th Edition)
Ch. 9.1 - How many protein-encoding genes are in the human...Ch. 9.1 - List three examples of how genomics has led to...Ch. 9.1 - What is one discovery resulting from the...Ch. 9.2 - What key molecules are essential for danger...Ch. 9.2 - Prob. 2MQCh. 9.2 - What is the major problem in identifying genes...Ch. 9.2 - How can protein homology assist in genome...Ch. 9.3 - What lifestyle is typical of Bacteria and Archaea...Ch. 9.3 - Prob. 2MQCh. 9.3 - Prob. 3MQ
Ch. 9.3 - Prob. 1CRCh. 9.4 - Prob. 1MQCh. 9.4 - Prob. 2MQCh. 9.4 - Prob. 3MQCh. 9.4 - Which genomes are larger, those of chloroplasts or...Ch. 9.5 - Prob. 1MQCh. 9.5 - Prob. 2MQCh. 9.5 - Prob. 3MQCh. 9.5 - What is the major difference in how duplications...Ch. 9.6 - Which class of genes is rarely transferred...Ch. 9.6 - List the major mechanisms by which horizontal gene...Ch. 9.6 - How might transposons be especially important in...Ch. 9.6 - Explain how horizontally transferred genes can be...Ch. 9.7 - Prob. 1MQCh. 9.7 - Prob. 2MQCh. 9.7 - Prob. 3MQCh. 9.7 - Explain how chromosomal islands might move between...Ch. 9.8 - Prob. 1MQCh. 9.8 - How is a metagenome analyzed?Ch. 9.8 - Prob. 1CRCh. 9.9 - Prob. 1MQCh. 9.9 - Prob. 2MQCh. 9.9 - Prob. 3MQCh. 9.9 - Prob. 1CRCh. 9.10 - Why is the term proteome ambiguous, whereas the...Ch. 9.10 - Prob. 2MQCh. 9.10 - Prob. 3MQCh. 9.10 - Prob. 1CRCh. 9.11 - Prob. 1MQCh. 9.11 - What is a secondary metabolite?Ch. 9.11 - Prob. 1CRCh. 9.12 - How are single cells isolated from a mixed...Ch. 9.12 - Prob. 2MQCh. 9.12 - How can single-cell genomics be used to address...Ch. 9.13 - Prob. 1MQCh. 9.13 - Prob. 2MQCh. 9.13 - Prob. 1CRCh. 9.14 - Prob. 1MQCh. 9.14 - Prob. 2MQCh. 9.14 - Prob. 1CRCh. 9 - Apart from genome size, what factors make complete...Ch. 9 - Describe how one might determine which proteins In...Ch. 9 - The gene encoding the beta subunit of RNA...Ch. 9 - Describe how you could use systems biology to...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Given the following DNA, (A) what is the transcript (MRNA) sequence? (B) What might be the amino acid sequence of the translated protein? 5'– ATGGCGAGGCGGCAGCTGTTATGGTGA – 3'arrow_forwardThe human proteome contains a much greater variety of proteins than would be predicted from the human genome. What molecular phenomenon best explains this diversity?arrow_forwardExplain about the proteome ?arrow_forward
- What is the proteome?arrow_forwardThe central dogma of molecular biology states simply that DNA encodes RNA, and RNA encodes protein. For each of the following processes, describe, 1) where in the cell they occur, 2) one important protein (or protein containing complex) involved 3) the result of this process. DNA replication Where?) Protein?) Result?) Transcription Where?) Protein?) Result?) Splicing Where?) Protein?) Result?) Translation Where?) Protein?) Result?)arrow_forward14) Why are telomeres so important in eukaryotic organisms? A) Without telomeres, important DNA could be lost every time the cell divides. B) They cap the mRNA, allowing it to pass through the nuclear membrane to the cytoplasm fo translation. C) They provide a repetitive DNA sequence needed by primers to recognize the beginning of transcription. D) They remain relatively undamaged from environmental stress and toxins.arrow_forward
- The biological process shown in Figure 1 occurs in a eukaryotic cell’s nucleus. a) What is the DNA base sequence of Codon 1? b) What is the anticodon sequence for Codon 1? c) Name the enzyme involved in the production of Y.arrow_forwardThe sequence A is read by RNA polymerase to produce an mRNA that is translated by the ribosome: Choose the sequence that would correspond to that mRNA. A: 3’ – TACGGAACG – 5’ B) 3’ – AUGCCUUGC – 5’ C) 5’ – AUGCCUUGC – 3’ D) 3’ – UACGGAACG – 5’ E) 5’ – UACGGAACG – 3’arrow_forwardComplete the protein synthesis for the partial DNA sequence for a normal FGFR3 gene (TOP) and mutated FGFR3 gene (BOTTOM). Remember, when filling in mRNA, use capital letters only. When filling in amino acids, use three letters, with the first letter capitalized. If you do not use this format, your answer may be marked wrong. DNA CCG TTC GGG GAA ССС MRNA Amino Acid DNA CCG TTC GGG GAA TCC MRNA Amino Acidarrow_forward
- What is the sequence of the mRNA transcript that will be produced from the following sequence of DNA? The top strand is the template strand, the bottom strand is the coding strand. 5’ – TCGGGATTAGACGCACGTTGGCATACCTCG – 3’ 3’ – AGCCCTAATCTGCGTGCAACCGTATGGAGC – 5’ Enter the mRNA sequence here (pay close attention to the direction of the molecule!): 5'-_____-3'arrow_forwarda) Identify three types of RNA and provide a description of each and the role they play in protein synthesis. (6 marks) b) Use the DNA sequence below to answer the following questions. 3' - TACGAACGAGTGCCCCAAAATT -5' What is the complementary DNA strand? (1 mark) What is the nucleotide sequence of the mRNA strand transcribed from the initial DNA strand? (1 mark) Provide an alternative mRNA sequence with four changes that would translate to the same amino acid sequence. (2 marks) Paragraph I A + v ... Lato (Recom... v 19px ... v Add a File Record Audio Record Video MacBook Pro G Search or type URL #3 2$ & ( 3 4 7 8 9 山訓 < COarrow_forwardSuppose that a DNA segment has the following nucleotide sequence: CTC ATA CGA TTC AAG TTA. Which of the following nucleotide sequences would be found in a complementary mRNA strand? (a) GAG UAU GAU AAC UUG AAU. (b) GAG TAT GCT AAG TTC AAT. (c) GAG UAU GCU AAG UUC AAU. (d) GUG UAU GGA UUG AAC GGU.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Genome Annotation, Sequence Conventions and Reading Frames; Author: Loren Launen;https://www.youtube.com/watch?v=MWvYgGyqVys;License: Standard Youtube License