Genetics: From Genes To Genomes (6th International Edition)
6th Edition
ISBN: 9781260041217
Author: Leland Hartwell Dr., ? Michael L. Goldberg Professor Dr., ? Janice Fischer, ? Leroy Hood Dr.
Publisher: Mcgraw-Hill
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 9, Problem 9P
Consider a partial restriction digestion, in which genomic DNA is exposed to a small, limiting amount of a restriction enzyme for a very short period of time.
| a. | Would the resultant fragments be longer or shorter or the same size as those produced by a complete digestion? |
| b. | If you prepared genomic DNA from a tissue sample containing millions of cells, would the fragments produced by partial digestion of DNA from all of these cells be the same or different? |
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
please do only part D .
After Drosophila DNA has been treated with a restriction enzyme, the fragments are inserted into plasmids and selected as clones in E. coli. With the use of this “shotgun” technique, every DNA sequence of Drosophila in a library can be recovered.a. How would you identify a clone that contains DNA encoding the protein actin, whose amino acid sequence is known?b. How would you identify a clone encoding a specific tRNA?
A linear DNA molecule is subjected to complete restriction digestion by (1) EcoRI alone, (2)
HindIII alone, and (3) both enzymes together. The DNA fragments are then separated using
gel electrophoresis. Results are shown below:
(i)
(ii)
(iii)
EcoRI Hindill Both
| |
—
| |
10 kb
9 kb
8 kb
5 kb
2 kb
1 kb
How long is the original DNA molecule?
How many EcoRI recognition sites does it have?
Does the longest EcoRI fragment contain a HindIII restriction site? Explain your
answer.
Chapter 9 Solutions
Genetics: From Genes To Genomes (6th International Edition)
Ch. 9 - Match each of the terms in the left column to the...Ch. 9 - For each of the restriction enzymes listed below:...Ch. 9 - The calculations of the average restriction...Ch. 9 - The DNA molecule whose entire sequence follows is...Ch. 9 - Why do longer DNA molecules move more slowly than...Ch. 9 - Agarose gels with different average pore sizes are...Ch. 9 - The following picture shows the ethidium...Ch. 9 - The linear bacteriophage genomic DNA has at each...Ch. 9 - Consider a partial restriction digestion, in which...Ch. 9 - The text stated that molecular biologists have...
Ch. 9 - a. What is the purpose of molecular cloning? b....Ch. 9 - a. DNA polymerase b. RNA polymerase c. A...Ch. 9 - Is it possible that two different restriction...Ch. 9 - A plasmid vector pBS281 is cleaved by the enzyme...Ch. 9 - A recombinant DNA molecule is constructed using a...Ch. 9 - Suppose you are using a plasmid cloning vector...Ch. 9 - Prob. 17PCh. 9 - The lacZ gene from E. coli encodes the enzyme...Ch. 9 - Your undergraduate research advisor has assigned...Ch. 9 - Which of the enzymes from the following list would...Ch. 9 - You use the primer 5 GCCTCGAATCGGGTACC 3 to...Ch. 9 - a. To make a genomic library useful for sequencing...Ch. 9 - Problem 15 showed part of the sequence of the...Ch. 9 - Eukaryotic genomes are replete with repetitive...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- a. What type of nucleic acid and from what species would the scientist use to begin construction of her genomic DNA library? b. From what tissue would she isolate this nucleic acid? c. What type of reagent would the scientist use to cut the genome into appropriately sized fragments? d. What size nucleic acid fragments would one aim to prepare for the library construction so as to to avoid having to screen an overwhelming number of clones? e. Into what vector would the scientist ligate her genomic DNA fragments? f. What organism would the scientist use to propagate the clones of her genomic DNA library? g. From the information given in the problem determine what probe could be used to screen the scientist's library to find her clone of interest ?arrow_forwardNucleosomes can be assembled onto defined DNA segments. When a particular 225-bp segment of human DNA was used to assemble nucleosomes and then incubated with micrococcal nuclease, which digests DNA that is not located within the nucleosome, uniform fragments 147 bp in length were generated. Subsequent digestion of these fragments with a restriction enzyme that cuts once within the original 225-bp sequence produced two well-defined bands at 37 bp and 110 bp. Why do you suppose two well-defined fragments were generated by restriction digestion, rather than a range of fragments of different sizes? How would you interpret this result?arrow_forwardA. A plasmid is shown with the locations of various restriction enzyme sites labeled. If you cut the plasmid with Xhol and Xbal, which lane of the agarose gel represents the DNA fragments you would expect from the digestion? B. If you now decide to cut the plasmid with EcoRI, how many fragments will be produced and what will their sizes be? C. When running DNA samples on agarose gel, an electric field is applied. Towards which electrode will the DNA migrate and why?arrow_forward
- A small DNA molecule was cleaved with several different restriction nucleases, and the size of each fragment was determined by gel electrophoresis.The following data were obtained. (a) Is the original molecule linear or circular?(b) Draw a map of restriction sites (showing distances between sites) that isconsistent with the data given.(c) How many additional maps are compatible with the data?(d) What would have to be done to locate the cleavage sites unambiguouslywith respect to each other?arrow_forwardFor the given restriction enzyme: BslI (CCNNNNN^NNGG) i) Approximately how many fragments would result from digestion of the human genome (3 × 109 bases) with the enzyme? ii) Estimate the average size of the pieces of the human genome produced by digestion with the enzyme. iii) State whether the fragments of human DNA produced by digestion with the given enzyme would have sticky ends with a 5′ overhang, sticky ends with a 3′ overhang, or blunt ends. iv) If the enzyme produces sticky ends, would all the overhangs on all the ends produced by that enzyme on all fragments of the human genome be identical, or not? The recognition sequence on one strand for the enzyme is given in parentheses, with the 5′ end written at the left. N means any of the four nucleotides; R is any purine—that is, A or G; and Y is any pyrimidine—that is, C or T. ^ marks the site of cleavage. Note that the recognition sites containing Ys and Rs are not always rotationally symmetrical.arrow_forwardThe restriction endonuclease NciI recognizes and cuts the five-base-pair sequence 5’- CC(G/C)GG-3’ [where (G/C) means either G or C will work at that position]. (1) How often, on average, would this sequence occur in random DNA? Assume the DNA contains 25% each of A, G, T & C. (2) After digestion, Nci1 leaves a one-base 5’ overhang. Write/draw the cut site/digested products.arrow_forward
- Examine the sequence for the DNA fragment below. Your job is to design primers for PCR that would be able to amplify this entire DNA fragment. Your answer must fulfill the following criteria: Design the primers so that they are each 7 bases in length. Please write out the sequence of these primers. Don’t forget to indicate the direction (polarity) of both ends of each primer. Note that only the polarity of one end of one of the template strands of DNA is provided below. Describe where the primer would bind (i.e. top or bottom template strand, left or right side of the DNA strand) Organize your response so that each primer, and associated information, is separated by at least one blank linearrow_forwardWhen joining two or more DNA fragments, a researcher can adjust the sequence at the junction in a variety of subtle ways, as seen in the following exercises.(a) Draw the structure of each end of a linear DNA fragment produced by an EcoRI restriction digest (include those sequences remaining from the EcoRI recognition sequence).(b) Draw the structure resulting from the reaction of this end sequence with DNA polymerase I and the four deoxynucleoside triphosphates.(c) Draw the sequence produced at the junction that arises if two ends with the structure derived in (b) are ligated (d) Draw the structure produced if the structure derived in (a) is treated with a nuclease that degrades only single-stranded DNA.(e) Draw the sequence of the junction produced if an end with structure (b) is ligated to an end with structure (d).(f) Draw the structure of the end of a linear DNA fragment that was produced by a PvuII restriction digest (include those sequences remaining from the PvuII recognition…arrow_forwarda. Given the following restriction map of a cloned 10 kb piece of DNA, what size fragments would you see after digesting this linear DNA fragment with each of the enzymes or combinations of enzymes listed: (1) EcoRI, (2) BamHI, (3) EcoRI + HindlII, (4) BamHI + Psl, and (5) EcoRI + BamHI. b. What fragments in the last three double digests would hybridize with a probe made from the 4 kb BamHI fragment? E HH E ++ + 1.5 0.6 1.0 1.2 B E + 2.1 1.9 1.7 kbarrow_forward
- A 10 kb DNA fragment digested with the restriction endonuclease EcoRI yields fragments of 4 kb and 6 kb. When the 10 kb fragment is digested with BamHI, three fragments of 1, 3.5 and 5.5 kb are generated. Digestion with both enzymes yields four fragments of 0.5, 1, 3 and 5.5 kb. Draw the restriction map for the 10 kb fragment based on the data. Label the cut sites for the two enzymes, and the lengths between the cut sites.arrow_forwardA researcher is interested in using the in vitro technique of bisulfite conversion to confirm the methylation status of a DNA sequence. A. In vitro Sodium bisulfite treatment of DNA results in what type of chemical reaction? i. Which bases are preferentially affected? B. What nucleotide change is expected immediately following sodium bisulfite treatment of the DNA? C. You analyze the following DNA sequence before bisulfite treatment and after bisulfite treatment followed by a 30-cycle PCR reaction. Based on sequence comparison, how many cytosines were unmethylated in the original DNA sequence? Briefly explain how you came to this conclusion. Before bisulfite treatment: After bisulfite treatment and a 30-cycle PCR reaction: 5' CGACGCGCGATTCATTCGATT 3' 5' TGACGCGTGATTTATTTGATT 3'arrow_forwardplease helparrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Biology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Molecular Techniques: Basic Concepts; Author: Dr. A's Clinical Lab Videos;https://www.youtube.com/watch?v=7HFHZy8h6z0;License: Standard Youtube License