Starting Out with C++ from Control Structures to Objects (9th Edition)
9th Edition
ISBN: 9780134498379
Author: Tony Gaddis
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Expert Solution & Answer
Chapter 9, Problem 46RQE
Explanation of Solution
Null pointer:
When the address of pointer is set to “0” or when a pointer variable does not hold any value, then it is called as null pointers.
Example:
Consider the below example, pointer variable of integer data type initialized as null pointer:
// Defin...
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Code write () 9.
Write code
Can help me code this please
Chapter 9 Solutions
Starting Out with C++ from Control Structures to Objects (9th Edition)
Ch. 9.5 - Prob. 9.1CPCh. 9.5 - Write the definition statement for a variable...Ch. 9.5 - List three uses of the symbol in C++.Ch. 9.5 - What is the output of the following code? int x =...Ch. 9.5 - Rewrite the following loop so it uses pointer...Ch. 9.5 - Prob. 9.6CPCh. 9.5 - Prob. 9.7CPCh. 9.5 - Is each of the following definitions valid or...Ch. 9.9 - Prob. 9.9CPCh. 9.9 - Give an example of the proper way to call the...
Ch. 9.9 - Complete the following program skeleton. When...Ch. 9.9 - Look at the following array definition: const int...Ch. 9.9 - Assume ip is a pointer to an int. Write a...Ch. 9.9 - Prob. 9.14CPCh. 9.9 - Prob. 9.15CPCh. 9.9 - Prob. 9.16CPCh. 9.9 - Prob. 9.17CPCh. 9 - What does the indirection operator do?Ch. 9 - Look at the following code. int x = 7; int iptr =...Ch. 9 - So far you have learned three different uses for...Ch. 9 - Prob. 4RQECh. 9 - Prob. 5RQECh. 9 - Prob. 6RQECh. 9 - What is the purpose of the new operator?Ch. 9 - What happens when a program uses the new operator...Ch. 9 - Prob. 9RQECh. 9 - Prob. 10RQECh. 9 - Prob. 11RQECh. 9 - Prob. 12RQECh. 9 - Each byte in memory is assigned a unique...Ch. 9 - The _________ operator can be used to determine a...Ch. 9 - Prob. 15RQECh. 9 - The ________ operator can be used to work with the...Ch. 9 - Array names can be used as ________, and vice...Ch. 9 - Prob. 18RQECh. 9 - The ________ operator is used to dynamically...Ch. 9 - Under older compilers, if the new operator cannot...Ch. 9 - Prob. 21RQECh. 9 - When a program is finished with a chunk of...Ch. 9 - You should only use pointers with delete that were...Ch. 9 - Prob. 24RQECh. 9 - Look at the following array definition: int...Ch. 9 - Prob. 26RQECh. 9 - Assume tempNumbers is a pointer that points to a...Ch. 9 - Look at the following function definition: void...Ch. 9 - Prob. 29RQECh. 9 - Prob. 30RQECh. 9 - Prob. 31RQECh. 9 - T F The operator is used to get the address of a...Ch. 9 - T F Pointer variables are designed to hold...Ch. 9 - T F The symbol is called the indirection...Ch. 9 - T F The operator dereferences a pointer.Ch. 9 - T F When the indirection operator is used with a...Ch. 9 - T F Array names cannot be dereferenced with the...Ch. 9 - Prob. 38RQECh. 9 - T F The address operator is not needed to assign...Ch. 9 - T F You can change the address that an array name...Ch. 9 - T F Any mathematical operation, including...Ch. 9 - T F Pointers may be compared using the relational...Ch. 9 - T F When used as function parameters, reference...Ch. 9 - T F The new operator dynamically allocates memory.Ch. 9 - T F A pointer variable that has not been...Ch. 9 - Prob. 46RQECh. 9 - T F In using a pointer with the delete operator,...Ch. 9 - Prob. 48RQECh. 9 - Prob. 49RQECh. 9 - int x, ptr = nullptr; ptr = x;Ch. 9 - Prob. 51RQECh. 9 - Prob. 52RQECh. 9 - Prob. 53RQECh. 9 - float level; int fptr = level;Ch. 9 - Prob. 55RQECh. 9 - Prob. 56RQECh. 9 - Prob. 57RQECh. 9 - Prob. 58RQECh. 9 - int pint = nullptr; pint = new int[100]; //...Ch. 9 - Prob. 60RQECh. 9 - Prob. 61RQECh. 9 - Prob. 62RQECh. 9 - Array Allocator Write a function that dynamically...Ch. 9 - Test Scores #1 Write a program that dynamically...Ch. 9 - Drop Lowest Score Modify Problem 2 above so the...Ch. 9 - Test Scores #2 Modify the program of Programming...Ch. 9 - Prob. 5PCCh. 9 - Case Study Modification #1 Modify Program 9-19...Ch. 9 - Case Study Modification #2 Modify Program 9-19...Ch. 9 - Mode Function In statistics, the mode of a set of...Ch. 9 - Median Function In statistics, when a set of...Ch. 9 - Reverse Array Write a function that accepts an int...Ch. 9 - Array Expander Write a function that accepts an...Ch. 9 - Element Shifter Write a function that accepts an...Ch. 9 - Movie Statistics Write a program that can be used...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, computer-science and related others by exploring similar questions and additional content below.Similar questions
- 3. Show the stack with all activation record instances, including static and dynamic chains, when execution reaches position 1 in the following skeletal program. Assume bigsub is at level 1. function bigsub() { function a(flag) { function b() { *** a(false); } // end of b *** *** if (flag) b(); else c(); } // end of a function c() { function d() { <--- *** } // end of d d(); } // end of c *** 2 a(true); } // end of bigsub The calling sequence for this program for execution to reach dis bigsub calls a a calls b 12arrow_forwardQ5: In C programming, "Char" and "int" data types are used. They represent certain number of bits. Please fill in the blanks for following data types assuming that that the code is running on 32 bit machine. Data type Total number of bits/bytes int chararrow_forward5- is the hierarchy of operations. O 1,&, +/ O :, +,-, & O I., &,.^ O 1.&,/.+arrow_forward
- A pointer that contains the address O is called a(n) ____ pointer .arrow_forwardFill-in-the-Blank A pointer that contains the address 0 is called a(n) __________ pointer.arrow_forwardProblem Statement The barcode used by the U.S. Postal System to route mail is defined as follows: Each decimal digit in the ZIP code is encoded using a sequence of three half-height and two full-height bars. The barcode starts and ends with a full-height bar (the guard rail) and includes a checksum digit (after the five-digit ZIP code or ZIP + 4), computed by summing up the original digits modulo 10. Define the following functions: Draw a half-height or full-height bar on stddraw. Given a digit, draw its sequence of bars. Compute the checksum digit. Also define global code that read in a five- (or nine-) digit ZIP code as the command-line argument and draws the corresponding postal barcode.arrow_forward
- Segmentation: Select all of the following statements that are true. In segmentation, a logical address always has a length of 32 bit. In order to translate logical into physical addresses, the memory management unit uses the segment part of the logical address to determine the start address in the segment table and adds the offset to this to get the physical address. In segmentation, the logical address consists of a segment part and an offset. The segment length is limited by the maximum possible segment number. When applying segmentation, processes are only allowed to access the memory within their segments. Segments can be assigned access rights and privilege levels.arrow_forward(Numerical) Write and test a function that returns the position of the largest and smallest values in an array of double-precision numbers.arrow_forward(Data processing) Your professor has asked you to write a C++ program that determines grades at the end of the semester. For each student, identified by an integer number between 1 and 60, four exam grades must be kept, and two final grade averages must be computed. The first grade average is simply the average of all four grades. The second grade average is computed by weighting the four grades as follows: The first grade gets a weight of 0.2, the second grade gets a weight of 0.3, the third grade gets a weight of 0.3, and the fourth grade gets a weight of 0.2. That is, the final grade is computed as follows: 0.2grade1+0.3grade2+0.3grade3+0.2grade4 Using this information, construct a 60-by-7 two-dimensional array, in which the first column is used for the student number, the next four columns for the grades, and the last two columns for the computed final grades. The program’s output should be a display of the data in the completed array. For testing purposes, the professor has provided the following data:arrow_forward
- Assembly language 32 bit MASM IrvineYou are to ask the user for a number from 5 - 20. You will then do the Fibonacci sequence up to that number. You may need to research the Fibonacci sequence first. Example: Please enter a number from 5 - 20: 10 0, 1, 1, 2, 3, 5, 8, 13, 21, 34 Note, the user typed 10, so it shows the first 10 numbers of the sequence. The initial numbers the computer should start with are the 0 and the 1 at the start. Please add a **Loop** in the programarrow_forwardFill-in-the-Blank The __________ operator is used to dynamically allocate memory.arrow_forwardC++ Code: This function will print out the information that has been previously read (using the function readData) in a format that aligns an individual's STR counts along a column. For example, the output for the above input will be: name Alice Bob Charlie ---------------------------------------- AGAT 5 3 6 AATG 2 7 1 TATC 8 4 5 This output uses text manipulators to left-align each name and counts within 10 characters. The row of dashes is set to 40 characters. /** * Computes the longest consecutive occurrences of several STRs in a DNA sequence * * @param sequence a DNA sequence of an individual * @param nameSTRs the STRs (eg. AGAT, AATG, TATC) * @returns the count of the longest consecutive occurrences of each STR in nameSTRs **/ vector<int> getSTRcounts(string& sequence, vector<string>& nameSTRs) For example, if the sequence is AACCCTGCGCGCGCGCGATCTATCTATCTATCTATCCAGCATTAGCTAGCATCAAGATAGATAGATGAATTTCGAAATGAATGAATGAATGAATGAATGAATG and the vector namesSTRs is…arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Systems ArchitectureComputer ScienceISBN:9781305080195Author:Stephen D. BurdPublisher:Cengage LearningC++ for Engineers and ScientistsComputer ScienceISBN:9781133187844Author:Bronson, Gary J.Publisher:Course Technology PtrMicrosoft Visual C#Computer ScienceISBN:9781337102100Author:Joyce, Farrell.Publisher:Cengage Learning,
- C++ Programming: From Problem Analysis to Program...Computer ScienceISBN:9781337102087Author:D. S. MalikPublisher:Cengage Learning
Systems Architecture
Computer Science
ISBN:9781305080195
Author:Stephen D. Burd
Publisher:Cengage Learning
C++ for Engineers and Scientists
Computer Science
ISBN:9781133187844
Author:Bronson, Gary J.
Publisher:Course Technology Ptr
Microsoft Visual C#
Computer Science
ISBN:9781337102100
Author:Joyce, Farrell.
Publisher:Cengage Learning,
C++ Programming: From Problem Analysis to Program...
Computer Science
ISBN:9781337102087
Author:D. S. Malik
Publisher:Cengage Learning