Biology: The Unity and Diversity of Life (MindTap Course List)
15th Edition
ISBN: 9781337408332
Author: Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr
Publisher: Cengage Learning
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 9, Problem 14SQ
Energy that drives translation is provided mainly by ___ .
- a. ATP
- b. amino acids
- c. CTP
- d. all of the above
Expert Solution & Answer
Trending nowThis is a popular solution!
Students have asked these similar questions
Energy that drives translation is provided mainly by______ . a. ATP c. GTP b. amino acids d. all of the above
In RNA, ___________ pairs with adenine.
A.Group of answer choices
cytosine
guanine
thymine
uracil
B.The main differences between introns and exon is
Group of answer choices
Exons code for amino acids and Introns do not
Introns code for RNA and exons code for DNA
Introns code for amino acids and exons do not
Introns enter the nucleus and exons leave the nucleus
The formation of peptide bonds between amino acids occurs _____.
a. during transcription
b. during the elongation step to translation
c. during the assemble of the ribosome and mRNA
d. while DNA is being replicated
Chapter 9 Solutions
Biology: The Unity and Diversity of Life (MindTap Course List)
Ch. 9 - RIPs as Cancer Drugs Researchers are taking a page...Ch. 9 - RIPs as Cancer Drugs Researchers are taking a page...Ch. 9 - RIPs as Cancer Drugs Researchers are taking a page...Ch. 9 - RIPs as Cancer Drugs Researchers are taking a page...Ch. 9 - A chromosome contains many different genes that...Ch. 9 - A binding .site for RNA polymerase is called a ___...Ch. 9 - In cells, most RNA molecules are ___ ; most DNA...Ch. 9 - Prob. 4SQCh. 9 - The main function of a DNA molecule is to ________...Ch. 9 - The main function of an mRNA molecule is to ___ ....
Ch. 9 - Prob. 7SQCh. 9 - Prob. 8SQCh. 9 - Prob. 9SQCh. 9 - Anticodons pair with ___ . a. mRNA codons b. DNA...Ch. 9 - Prob. 11SQCh. 9 - Prob. 12SQCh. 9 - Prob. 13SQCh. 9 - Energy that drives translation is provided mainly...Ch. 9 - Match the terms with the best description. ______...Ch. 9 - Researchers are designing and testing antisense...Ch. 9 - An anticodon has the sequence GCG. What amino acid...Ch. 9 - Each position of a codon can be occupied by one of...Ch. 9 - Prob. 4CTCh. 9 - Translate the .sequence of bases in the previous...Ch. 9 - Can you .spell your name (or someone else's) using...Ch. 9 - Bacteria use the.same stop codons as eukaryotes....
Additional Science Textbook Solutions
Find more solutions based on key concepts
Gregor Mendel never saw a gene, yet he concluded that some inherited factors were responsible for the patterns ...
Campbell Essential Biology (6th Edition) - standalone book
Single penny tossed 20 times and counting heads and tails: Probability (prediction): _______/20 heads ________/...
Laboratory Manual for Holes Human Anatomy & Physiology Fetal Pig Version
Why do scientists think that all forms of life on earth have a common origin?
Genetics: From Genes to Genomes, 5th edition
WHAT IF? As a cell begins the process of dividing, its chromosomes become shorter, thicker, and individually vi...
Campbell Biology in Focus (2nd Edition)
Visit this site (http://openstaxcollege.org/l/heartvalve) to observe an echocardiogram of actual heart valves o...
Anatomy & Physiology
Why are mutants used as test organisms in the Ames test?
Laboratory Experiments in Microbiology (12th Edition) (What's New in Microbiology)
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Genetic expression involves transcription and translation. Match the structure or molecule to the step. a. promoter region b. RNA polymerase c. antisense strand d. poly-A tail е. 5 саp f. splicing g. anticodon loop h. acceptor stem i. peptide bond j. A site 57. transcribed strand that will go on to translation 58. site where tRNA with amino acid enters the ribosome 59. intron sequences are removed and exons are combined together 60. site where amino acid combines with tRNAarrow_forwardWhich of the following molecules is (are) produced by translation? Mark all the correct answers. A. RNA polymerase B. The digestive enzyme pepsin C. Ribosomal proteins D. Transfer RNA E. The amino acid glycine revious NEXT Save Exit AMooRook Pro 身arrow_forward20. Initiation and elongation in translation requires A ATP B.TTP C. GTP D. CTParrow_forward
- 1. The poly A tail of an mRNA molecule was removed by a deadenylase enzyme before it is recognized by the ribosomes. What will happen to this mRNA? a. It will not be translated anymore and will be degraded. b. It will get stuck in the small ribosomes since it will be difficult to set the proper start site. c. The reading frame of translation will change. d.The mRNA will be bound by the ribosomes for translation. 2. Which of the following is true regarding these DNA repair mechanisms? a. Non-homologous end joining is less likely to produce mutations than homologous recombination. b. Errors during DNA synthesis that are not caught by the replication machinery can be corrected by mismatch repair. c. DNA damage from chemical reactions cannot be undone. d. Proofreading from DNA polymerase I reduces the error rate in DNA to about 1 in 100 nucleotides. 3. Which of the following enzymes involved in DNA replication correctly pairs with its function? a. Helicase seals gaps between DNA…arrow_forwardEnergy that drives translation is provided mainly by ______ . a. ATP c. GTP b. amino acids d. ribosomesarrow_forwardDuring transcription, uracil pairs with ___. A. cytosine B. thymine C. guanine D. adenine E. ribosearrow_forward
- What would be the direct consequence to a cell of loss-of-function of Elongation Factor-Tu (EF-Tu)? You may select multiple answers. a. tRNAs would fail to exit the E site after giving up their amino acid. b. The error rate of translation would increase. c. The ribosome would frequently fail to identify the correct start codon and initiation of translation would become less efficient. d. There would be no pause between the entry of a tRNA into the A site and peptidyl transfer.arrow_forwarda.Label the diagram b.What is one differences between initiation of prokaryotic and eukaryotic translation? A A AUCG 5'TT GGGUUUACG G E B.arrow_forwardPut the events of translation in order. A. Ribosome reads the start codon and initites transcription B. The ribosome recruits the correct tRNA to its binding site. C. Peptide bond occurs betweeen two amino acids D. The "empty" tRNA leaves the ribosomesarrow_forward
- During translation, when a stop codon is read on the mRNA strand at the ribosome... a the mRNA is digested by a protease complex b a repressor attached to the ribosome that inhibits the movement of the ribosome along the mRNA c the enzyme helicase binds to terminate the polypeptide d a release factor enters the A site of the ribosome and stimulates the disassembly of the translation complex Codons are... a triplets coding for a single amino acid. b redundant in their coding for various amino acids. c matched with anticodons during translation d triplets found on transfer RNA Question 6 (1 point) In order to produce many copies of the same protein in a short period of time, the cell uses... a intron self-splicing. b many RNA polymerase molecules to produce multiple mRNA transcripts at the same time. c single-unit ribosomes for high speed translation. d codon-anticodon reciprocal…arrow_forwardDuring translation, amino acid chain termination requires a. a hydrolysis reaction to break off tRNA from the ribosome subunit b. elongation factors after termination hydrolysis c. a start codon to signal new chain d. stop signals from initiation complexarrow_forward1. DNA: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’mRNA:polypeptide chain: 2. a. From the given DNA sequence above, change one base in codon 6 to show nonsense mutation.Rewrite the resulting DNA sequence below and encircle the base that you changed.DNA:mRNA:polypeptide chain:b. Identify the type of base pair substitution that you applied in codon 6 3. a. From the given DNA sequence above, change the third base in codon 4 to show missense mutation. Rewrite the resulting DNA sequence below and encircle the base that you changed.DNA:mRNA:polypeptide chain:b. Identify the type of base pair substitution that you applied in codon 4 4. a. From the given DNA sequence above, change one base in codon 8 to show same sense mutation.Rewrite the resulting DNA sequence below and encircle the base that you changed.DNA:mRNA:polypeptide chain:b. Identify the type of base pair substitution that you applied in codon 8 5. Add an A before codon 3 or delete the middle base in codon 3 to show the shift of reading…arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
What is Genomics - Full Length; Author: Genome BC;https://www.youtube.com/watch?v=mmgIClg0Y1k;License: Standard youtube license