Concept explainers
For each of the terms in the left column, choose the best matching phrase in the right column.
a. transformation | 1. The strand that is synthesized discontinuously during replication |
b. bacteriophage | 2. The sugar within the |
c. pyrimidine | 3. a nitrogenous base containing a double ring |
d. deoxyribose | 4. noncovalent bonds that hold the two strands of the double helix together |
e. hydrogen bonds | 5. Meselson and Stahl experiment |
f. complementary bases | 6. Griffith experiment |
g. origin | 7. Structures at ends of eukaryotic chromosomes |
h. Okazaki fragments | 8. two nitrogenous bases that can pair via hydrogen bonds |
i. purine | 9. a nitrogenous base containing a single ring |
j. topoisomerases | 10. a short sequence of bases where unwinding of the double helix for replication begins |
k. semiconservative replication | 11. a virus that infects bacteria |
l. lagging strand | 12. short DNA fragments formed by discontinuous replication of one of the strands |
m. telomeres | 13. Enzymes involved in controlling DNA supercoiling |
a.
To determine:
The phrase that describes “transformation” among the options given below.
1. the strand that is synthesized discontinuously during replication
2. the sugar within the nucleotide subunits of DNA
3. a nitrogenous base containing a double ring
4. noncovalent bonds that hold the two strands of the double helix together
5. Meselson and Stahl experiment
6. Griffith experiment
7. structures at ends of eukaryotic chromosomes
8. two nitrogenous bases that can pair via hydrogen bonds
9. a nitrogenous base containing a single ring
10. a short sequence of bases w here unw inding of the double helix for replication begins
11. a virus that infects bacteria
12. short DNA fragments formed by discontinuous replication of one of the strands
13. enzymes involved in controlling DNA supercoiling
Introduction:
transformation is one of the mechanisms by which bacteria transfer genes from one strain to another. It occurs when DNA from a donor is added to the bacterial growth medium and is then taken up from the medium by the recipient. The recipient cell is called a transformant.
Answer to Problem 1P
Correct answer:
Transformation: Griffith experiment
Explanation of Solution
Griffith experiment shows that the transformation is the process of alteration of cellular genetics. This can be done by the incorporation of the exogenous material into the genetic makeup of an organism.
b.
To determine:
The phrase that describes “bacteriophage” among the options given below.
1. the strand that is synthesized discontinuously during replication
2. the sugar within the nucleotide subunits of DNA
3. a nitrogenous base containing a double ring
4. noncovalent bonds that hold the two strands of the double helix together
5. Meselson and Stahl experiment
6. Griffith experiment
7. structures at ends of eukaryotic chromosomes
8. two nitrogenous bases that can pair via hydrogen bonds
9. a nitrogenous base containing a single ring
10. a short sequence of bases w here unw inding of the double helix for replication begins
11. a virus that infects bacteria
12. short DNA fragments formed by discontinuous replication of one of the strands
13. enzymes involved in controlling DNA supercoiling
Introduction:
Bacteriophage a virus for which the natural host is a bacterial cell. They are known as bacteria-eaters.
Answer to Problem 1P
Correct answer:
Bacteriophage: A virus that infects bacteria
Explanation of Solution
A bacteriophage is a type of virus that infects bacteria. This virus is made up of nucleic acid molecule which is surrounded by a protein layer called capsid.
c.
To determine:
The phrase that describes “pyrimidine” among the options given below.
1. the strand that is synthesized discontinuously during replication
2. the sugar within the nucleotide subunits of DNA
3. a nitrogenous base containing a double ring
4. noncovalent bonds that hold the two strands of the double helix together
5. Meselson and Stahl experiment
6. Griffith experiment
7. structures at ends of eukaryotic chromosomes
8. two nitrogenous bases that can pair via hydrogen bonds
9. a nitrogenous base containing a single ring
10. a short sequence of bases w here unw inding of the double helix for replication begins
11. a virus that infects bacteria
12. short DNA fragments formed by discontinuous replication of one of the strands
13. enzymes involved in controlling DNA supercoiling
Introduction:
pyrimidines are a chemical group that includes the nitrogenous bases cytosine, thymine, and uracil.
Answer to Problem 1P
Correct answer:
Pyrimidine: A nitrogenous base containing a single ring
Explanation of Solution
Pyrimidine is a nitrogenous base that consists of two nitrogen and four carbons. It is a single ring structure. It catalyzes site-specific recombination.
d.
To determine:
The phrase that describes “deoxyribose” among the options given below.
1. the strand that is synthesized discontinuously during replication
2. the sugar within the nucleotide subunits of DNA
3. a nitrogenous base containing a double ring
4. noncovalent bonds that hold the two strands of the double helix together
5. Meselson and Stahl experiment
6. Griffith experiment
7. structures at ends of eukaryotic chromosomes
8. two nitrogenous bases that can pair via hydrogen bonds
9. a nitrogenous base containing a single ring
10. a short sequence of bases w here unw inding of the double helix for replication begins
11. a virus that infects bacteria
12. short DNA fragments formed by discontinuous replication of one of the strands
13. enzymes involved in controlling DNA supercoiling
Introduction:
Deoxyribose is a molecule similar to ribose, except that the 2′ carbon has a hydrogen rather than a hydroxyl group.
Answer to Problem 1P
Correct answer:
Deoxyribose: The sugar within the nucleotide subunits of DNA
Explanation of Solution
Deoxyribose is the pentose sugar that forms the backbone of DNA. This sugar is derived from ribose sugar by loss of oxygen molecule.
e.
To determine:
The phrase that describes “hydrogen bonds” among the options given below.
1. the strand that is synthesized discontinuously during replication
2. the sugar within the nucleotide subunits of DNA
3. a nitrogenous base containing a double ring
4. noncovalent bonds that hold the two strands of the double helix together
5. Meselson and Stahl experiment
6. Griffith experiment
7. structures at ends of eukaryotic chromosomes
8. two nitrogenous bases that can pair via hydrogen bonds
9. a nitrogenous base containing a single ring
10. a short sequence of bases w here unw inding of the double helix for replication begins
11. a virus that infects bacteria
12. short DNA fragments formed by discontinuous replication of one of the strands
13. enzymes involved in controlling DNA supercoiling
Introduction:
Hydrogen bonds are weak electrostatic bonds that result in a partial sharing of hydrogen atoms between reacting groups.
Answer to Problem 1P
Correct answer:
Hydrogen bonds: Noncovalent bonds that hold the two strands of the double helix together
Explanation of Solution
Hydrogen bond is an electrostatic bond that occur between a hydrogen atom and a more electronegative atom. These bonds are responsible for holding the strands of DNA double helix together.
f.
To determine:
The phrase that describes “complementary bases” among the options given below.
1. the strand that is synthesized discontinuously during replication
2. the sugar within the nucleotide subunits of DNA
3. a nitrogenous base containing a double ring
4. noncovalent bonds that hold the two strands of the double helix together
5. Meselson and Stahl experiment
6. Griffith experiment
7. structures at ends of eukaryotic chromosomes
8. two nitrogenous bases that can pair via hydrogen bonds
9. a nitrogenous base containing a single ring
10. a short sequence of bases w here unw inding of the double helix for replication begins
11. a virus that infects bacteria
12. short DNA fragments formed by discontinuous replication of one of the strands
13. enzymes involved in controlling DNA supercoiling
Introduction:
Complementarity is the property of DNA whereby the base sequences of the two strands in the double helix are reverse complements of one another; A is opposite T, and G is opposite C.
Answer to Problem 1P
Correct answer:
Complementary bases: Two nitrogenous bases that can pair via hydrogen bonds
Explanation of Solution
The complementary bases are the two base pairs that are connected with the help of hydrogen bonds in the DNA strands.
g.
To determine:
The phrase that describes “origin” among the options given below.
1. the strand that is synthesized discontinuously during replication
2. the sugar within the nucleotide subunits of DNA
3. a nitrogenous base containing a double ring
4. noncovalent bonds that hold the two strands of the double helix together
5. Meselson and Stahl experiment
6. Griffith experiment
7. structures at ends of eukaryotic chromosomes
8. two nitrogenous bases that can pair via hydrogen bonds
9. a nitrogenous base containing a single ring
10. a short sequence of bases w here unw inding of the double helix for replication begins
11. a virus that infects bacteria
12. short DNA fragments formed by discontinuous replication of one of the strands
13. enzymes involved in controlling DNA supercoiling
Introduction:
The model of DNA replication was proposed by the scientists Watson and Crick. Unwinding of the double helix enables each of the two parental strands to function as a template for the synthesis of a new strand by the mechanism of complementary base pairing. As a result a single double helix is converted into two identical daughter double helixes
Answer to Problem 1P
Correct answer:
Origin: A short sequence of bases where unwinding of the double helix for replication begins
Explanation of Solution
Origin is a sequence of bases from where the DNA double helix unwinds. It is the point from where process of replication is initiated.
h.
To determine:
The phrase that describes “okazaki fragments” among the options given below.
1. the strand that is synthesized discontinuously during replication
2. the sugar within the nucleotide subunits of DNA
3. a nitrogenous base containing a double ring
4. noncovalent bonds that hold the two strands of the double helix together
5. Meselson and Stahl experiment
6. Griffith experiment
7. structures at ends of eukaryotic chromosomes
8. two nitrogenous bases that can pair via hydrogen bonds
9. a nitrogenous base containing a single ring
10. a short sequence of bases w here unw inding of the double helix for replication begins
11. a virus that infects bacteria
12. short DNA fragments formed by discontinuous replication of one of the strands
13. enzymes involved in controlling DNA supercoiling
Introduction:
Okazaki fragments are formed during DNA replication. They are small fragments of about 1000 bases that are joined after synthesis to form the lagging strand.
Answer to Problem 1P
Correct answer:
Okazaki fragments: Short DNA fragments formed by discontinuous replication of one of the strands.
Explanation of Solution
Okazaki fragments are the short stretch of DNA fragments which are formed by the discontinuous replication of one DNA strand.
i.
To determine:
The phrase that describes “purine” among the options given below.
1. the strand that is synthesized discontinuously during replication
2. the sugar within the nucleotide subunits of DNA
3. a nitrogenous base containing a double ring
4. noncovalent bonds that hold the two strands of the double helix together
5. Meselson and Stahl experiment
6. Griffith experiment
7. structures at ends of eukaryotic chromosomes
8. two nitrogenous bases that can pair via hydrogen bonds
9. a nitrogenous base containing a single ring
10. a short sequence of bases w here unw inding of the double helix for replication begins
11. a virus that infects bacteria
12. short DNA fragments formed by discontinuous replication of one of the strands
13. enzymes involved in controlling DNA supercoiling
Introduction:
Purines are a chemical group that includes the nitrogenous bases adenine and guanine.
Answer to Problem 1P
Correct answer:
Purine: A nitrogenous base containing a double ring
Explanation of Solution
The nitrogenous bases that contains double ring are purines. Adenine and guanine are the two types of purines present in double stranded DNA molecule.
j.
To determine:
The phrase that describes “topoisomerases” among the options given below.
1. the strand that is synthesized discontinuously during replication
2. the sugar within the nucleotide subunits of DNA
3. a nitrogenous base containing a double ring
4. noncovalent bonds that hold the two strands of the double helix together
5. Meselson and Stahl experiment
6. Griffith experiment
7. structures at ends of eukaryotic chromosomes
8. two nitrogenous bases that can pair via hydrogen bonds
9. a nitrogenous base containing a single ring
10. a short sequence of bases w here unw inding of the double helix for replication begins
11. a virus that infects bacteria
12. short DNA fragments formed by discontinuous replication of one of the strands
13. enzymes involved in controlling DNA supercoiling
Introduction:
DNA topoisomerases are a group of enzymes that assist relax supercoiling of the DNA helix by nicking one or both strands to allow the strands to rotate relative to each other.
Answer to Problem 1P
Correct answer:
Topoisomerases: Enzymes involved in controlling DNA supercoiling
Explanation of Solution
Topoisomerases are the group of enzymes which are involved in the over winding or under winding of the DNA. It controls the super coiling of double stranded DNA molecule.
k.
To determine:
The phrase that describes “semiconservative replication” among the options given below.
1. the strand that is synthesized discontinuously during replication
2. the sugar within the nucleotide subunits of DNA
3. a nitrogenous base containing a double ring
4. noncovalent bonds that hold the two strands of the double helix together
5. Meselson and Stahl experiment
6. Griffith experiment
7. structures at ends of eukaryotic chromosomes
8. two nitrogenous bases that can pair via hydrogen bonds
9. a nitrogenous base containing a single ring
10. a short sequence of bases w here unw inding of the double helix for replication begins
11. a virus that infects bacteria
12. short DNA fragments formed by discontinuous replication of one of the strands
13. enzymes involved in controlling DNA supercoiling
Introduction:
semiconservative replication is a mechanism of DNA replication in which each single strand of the parent double helix functions as template for synthesis of its complement. As a result two daughter double helixes that each contain one of the original DNA strands intact (conserved) and one completely new strand is produced.
Answer to Problem 1P
Correct answer:
Semiconservative replication: Meselson and Stahl experiment
Explanation of Solution
Meselson and Stahl experiment describe the semi conservative replication in which both the daughter strands have a copy of parent strand.
l.
To determine:
The phrase that describes “lagging strand” among the options given below.
1. the strand that is synthesized discontinuously during replication
2. the sugar within the nucleotide subunits of DNA
3. a nitrogenous base containing a double ring
4. noncovalent bonds that hold the two strands of the double helix together
5. Meselson and Stahl experiment
6. Griffith experiment
7. structures at ends of eukaryotic chromosomes
8. two nitrogenous bases that can pair via hydrogen bonds
9. a nitrogenous base containing a single ring
10. a short sequence of bases w here unw inding of the double helix for replication begins
11. a virus that infects bacteria
12. short DNA fragments formed by discontinuous replication of one of the strands
13. enzymes involved in controlling DNA supercoiling
Introduction:
During replication, the DNA strand replicated discontinuously, 5′ to 3′ away from the Y-shaped replication fork, as small Okazaki fragments that are ultimately joined into a continuous strand.
Answer to Problem 1P
Correct answer:
Lagging strand: The strand that is synthesized discontinuously during replication
Explanation of Solution
Lagging strand is the type of strand that is synthesized discontinuously. It consist of short DNA fragments that are synthesized during the process of DNA replication.
m.
To determine:
The phrase that describes “telomeres” among the options given below.
1. the strand that is synthesized discontinuously during replication
2. the sugar within the nucleotide subunits of DNA
3. a nitrogenous base containing a double ring
4. noncovalent bonds that hold the two strands of the double helix together
5. Meselson and Stahl experiment
6. Griffith experiment
7. structures at ends of eukaryotic chromosomes
8. two nitrogenous bases that can pair via hydrogen bonds
9. a nitrogenous base containing a single ring
10. a short sequence of bases w here unw inding of the double helix for replication begins
11. a virus that infects bacteria
12. short DNA fragments formed by discontinuous replication of one of the strands
13. enzymes involved in controlling DNA supercoiling
Introduction:
Telomeres are specialized terminal structures on eukaryotic chromosomes that ensure the regulation and accurate replication of the two ends of each linear chromosome.
Answer to Problem 1P
Correct answer:
Telomeres: Structures at ends of eukaryotic chromosomes
Explanation of Solution
Telomeres are the structures which are present at the end of the chromosome. These are the cap like structures that protect the chromosome.
Want to see more full solutions like this?
Chapter 6 Solutions
Genetics: From Genes to Genomes, 5th edition
- Which of the following statements about RNA is/are incorrect? I. RNA strand synthesis does not occur during replication. II. All RNA strands produced during transcription are translated into proteins. III. RNA strands are composed of 10 nucleotide bases per turn. IV. RNA strands can pair with a DNA strand. V. RNA may be synthesized in the 5'-3' orientation and vice-versa (3'-5') depending on the orientation of the template DNA strand O I, II, and IV O I, II, III, IV, and V O II, IV and V O II, IV and V OI, II, III and V O Il and IIIarrow_forwardTake each of the DNA sequences and complete ALL of the following steps: i. Find the DNA Replication Complement of each strand ii. Transcribe the complement strand of DNA into an mRNA strand Translate the mRNA strand into an Amino Acid strand iii. a. ATGGACGTATAGATGACAGGTAGATGTTTCAGGGGGATTTATCGATAG b. ATGGCCATTGAGTGTCAAAAGTCTCAATGA First base U UUU UUC UUA UUG CUU CUC C CUA CUG G U -phenylalanine (Phe) -leucine (Leu) GUU GUC GUA GUG leucine (Leu) AUU AUC isoleucine (lle) Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Second base ACU ACC AUA ACA AUG methionine (Met) (start) ACG -valine (Val) UCU UCC UCA UCG CCU CCC CCA CCG GCU GCC GCA GCG C -serine (Ser) -proline (Pro) -threonine (Thr) -alanine (Ala) UAU UAC UAA stop UAG stop CAU CAC CAA CAG AAU AAC AAA AAG A -tyrosine (Tyr) GAU GAC GAA GAG - histidine (His) -glutamine (Gln) - asparagine (Asn) -lysine (Lys) -aspartic acid (Asp) -glutamic acid (Glu) CGU CGC CGA CGG AGU AGC AGA AGG G -cysteine…arrow_forwardWhich of the following statements are true regarding the properties of DNA and RNA polymerase. Select all that apply. Both DNA and RNA polymerase synthesize nucleic acid strands in the 5" to 3' direction. Both DNA and RNA polymerase can initiate strand synthesis on their own. I. RNA polymerase initiates strand synthesis, while DNA polymerase depends upon an existing strand to continue synthesis. II. RNA polymerase only uses ribonucleotides for strand synthesis. DNA polymerase only uses deoxyribonucleotides for strand synthesis. V. Au DNA and RNA polymerases from eukaryotes behave very differently from DNA and RNA polymerases found in prokaryotes. O VI.arrow_forward
- Match Column A (Description) with Column B (protein/enzyme). unwinds the double helix of DNA in replication makes a short section of RNA to act as a primer links separate stretches of DNA stabilizes the unwinding of the helix relieves the tension in the double stranded DNA (dsDNA) facilitate the switching on of genes…arrow_forwardWhat is true of this figure? (can be multiple answers) a. the replication fork is asymmetrical b. the DNA strands are anti-parallel c. one strand runs 3’ to 5’ d. one strand runs 5’ to 3’ e. both strands have identical basesarrow_forwardLook at the double-stranded segment of DNA shown below. Imagine that the two strands have already been denatured, and the temperature has been decreased to an appropriate annealing temperature. Show where the two primers would anneal to the strands, then indicate the direction of extension on each new strand with an arrow. 5’--T C A G G A C G T A A G C T T G C A T A T C T C G A T G C T A A A T C A T—3’ 3’--A G T C C T G C A T T C G A A C G T A T A G A G C T A C G A T T T A G T A—5’ Primer #1: 3’ A C G A T T T 5’ Primer #2: 5’ G G A C G T A 3’arrow_forward
- 1)give 3 differences between replication in prokaryotes and replication in Eukaryotes 2)For each item in the following table, decide whether it is related or involved in transcription, translation or replication. 1. Splicing 2. Stop codon 3. Lagging strand 4. RNA polymerase 5. DNA polymerase 6. Telomerase 3) Give the mRNA and the polypeptide (amino acid sequence) that results from the following DNA template strand: DNA template T A C A C G G G C G T A mRNA Amino acid sequencearrow_forwardWhich statement below is true? Select one: a. Okazaki fragments are produced in eukaryotic DNA replication but not in prokaryotic DNA replication. b. In both eukaryotes and prokaryotes, the template strand of DNA is read in the template’s 3’ to 5’ direction, while the new strand DNA is synthesized in new strand’s 5’ to 3’ direction. c. In eukaryotes, synthesis of the new DNA strand is from 5’ to 3’, whereas in prokaryotes it is random. d. In eukaryotes, synthesis of the new DNA strand is from 5’ to 3’, whereas in prokaryotes it is from 3’ to 5’. e. In eukaryotes, synthesis of the new DNA strand is from 3’ to 5’, whereas in prokaryotes it is from 5’ to 3’.arrow_forwardDetermine what amino acid will be formed from the given DNA strand below: 3’ T A C A T G C C G A A T 5’ Note: Prepare the partner strand of this DNA. Discuss how will replication happen by mentioning the enzyme needed then transcribe to form mRNA. Discuss what will happen to mRNA, then translate, mentioning the anticodon to be used. Look at the genetic code to know what amino acid will become part of the polypeptide chain. 1. Partner DNA strand 2. the mRNA strand 3. the tRNA 4. the formed amino acidsarrow_forward
- Given the following sequence for one strand of a double-strand oligonucleotide: 5’ACCGTAAGGCTTTAG3’ a. Write the sequence for the complementary DNA strand. b. Write the sequence of the RNA complementary to the strand shownarrow_forwardWhich of the following substances is involved in de novo synthesis of purine nucleotides but not pyrimidine nucleotides () A, glutamine B, glutamate C, aspartic acid D, glycine What is wrong with the statement about the B-type DNA double helix model is that () A, the base plane and the pentose plane are perpendicular to each other B. The base plane is located outside the helix C. The two chains are stabilized by interbase hydrogen bonding D. is a right-handed spiral structure The enzymes in common with the following enzymes that catalyze glycolysis and gluconeogenesis are () A, hexokinase B, phosphoglycerate kinase C, 1, 6-2p-fructokinase and D, pyruvate kinase Which of the following enzyme catalyzed reactions does not involve the production or consumption of carbon dioxide () A, pyruvate carboxylase B, isocitrate dehydrogenase C, 6-P-gluconate dehydrogenase and D, succinate dehydrogenasearrow_forwardIn one, simple sentence define the function of the following 1. Helicase = 2. Alpha subunit of DNA polymerase III =arrow_forward
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education