
Microbiology: Principles and Explorations
9th Edition
ISBN: 9781118743164
Author: Jacquelyn G. Black, Laura J. Black
Publisher: WILEY
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 5, Problem 3SQ
Summary Introduction
To match: The following characteristics to either (a) autotrophs or (b) chemoheterotrophs.
Introduction: Among all the living things, the microbes are specifically versatile in the way in which they obtain energy. On the basis of the ways in which the microbes capture the energy and obtain carbon, they are categorized as autotrophs (self-feeding) and heterotrophs (other-feeding).
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanks
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
Chapter 5 Solutions
Microbiology: Principles and Explorations
Ch. 5 - How are photosynthesis and respiration related to...Ch. 5 - What is the main difference between...Ch. 5 - Distinguish between coenzyme and cofactor. How are...Ch. 5 - Prob. 2.2SCCh. 5 - Prob. 3.1SCCh. 5 - If four actual molecules of ATP are produced for...Ch. 5 - Prob. 3.3SCCh. 5 - Prob. 3.4SCCh. 5 - Prob. 4.1SCCh. 5 - What is returned to chlorophyll in cyclic...
Ch. 5 - What were probably the first kind of...Ch. 5 - What type of metabolism is characteristic of...Ch. 5 - Prob. 1CCSCh. 5 - Suppose that you had a culture known to contain...Ch. 5 - In what sequence might the different kinds of...Ch. 5 - Prob. 3CTQCh. 5 - Which of the following is not true about...Ch. 5 - Prob. 2SQCh. 5 - Prob. 3SQCh. 5 - Prob. 4SQCh. 5 - Prob. 5SQCh. 5 - Prob. 6SQCh. 5 - Prob. 7SQCh. 5 - Prob. 8SQCh. 5 - All of the following statements about competitive...Ch. 5 - Prob. 10SQCh. 5 - What is feedback inhibition? (a) When the end...Ch. 5 - Which of the following is true regarding the...Ch. 5 - Prob. 13SQCh. 5 - Prob. 14SQCh. 5 - During aerobic cell respiration most of the energy...Ch. 5 - The typical end products of complete aerobic cell...Ch. 5 - Prob. 17SQCh. 5 - The end products of photosynthesis in...Ch. 5 - Which of the following final electron acceptors is...Ch. 5 - Prob. 20SQCh. 5 - Prob. 21SQ
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Biology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- BiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage Learning
- Biology: The Unity and Diversity of Life (MindTap...BiologyISBN:9781305073951Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa StarrPublisher:Cengage Learning

Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning

Biology: The Unity and Diversity of Life (MindTap...
Biology
ISBN:9781305073951
Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Microbial Nutrition and Growth; Author: Scientist Cindy;https://www.youtube.com/watch?v=rK3UkyWjkl8;License: Standard YouTube License, CC-BY